Incidental Mutation 'R7383:Hsd17b4'
ID572911
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Namehydroxysteroid (17-beta) dehydrogenase 4
SynonymsD-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location50128201-50196269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50164850 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 402 (K402T)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
Predicted Effect probably benign
Transcript: ENSMUST00000025385
AA Change: K402T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: K402T

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50164845 missense probably benign
IGL01369:Hsd17b4 APN 18 50172033 missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50191814 missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50160126 splice site probably benign
IGL02126:Hsd17b4 APN 18 50181996 missense probably benign
IGL02496:Hsd17b4 APN 18 50155153 missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50160164 missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50162097 splice site probably benign
IGL02813:Hsd17b4 APN 18 50128348 utr 5 prime probably benign
I0000:Hsd17b4 UTSW 18 50160228 missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50146518 missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50191784 missense probably benign
R0734:Hsd17b4 UTSW 18 50170777 missense possibly damaging 0.90
R0967:Hsd17b4 UTSW 18 50183261 missense probably benign 0.00
R1418:Hsd17b4 UTSW 18 50130187 splice site probably benign
R1661:Hsd17b4 UTSW 18 50160215 missense probably benign
R1665:Hsd17b4 UTSW 18 50160215 missense probably benign
R1752:Hsd17b4 UTSW 18 50170767 missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50177984 missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50183302 splice site probably null
R4351:Hsd17b4 UTSW 18 50142634 missense probably damaging 1.00
R4405:Hsd17b4 UTSW 18 50128314 start gained probably benign
R4976:Hsd17b4 UTSW 18 50160135 missense probably damaging 1.00
R5788:Hsd17b4 UTSW 18 50173709 missense probably damaging 0.99
R5826:Hsd17b4 UTSW 18 50183172 missense probably benign 0.00
R5889:Hsd17b4 UTSW 18 50177209 missense probably damaging 1.00
R6475:Hsd17b4 UTSW 18 50172262 intron probably null
R6632:Hsd17b4 UTSW 18 50179102 missense possibly damaging 0.70
R7151:Hsd17b4 UTSW 18 50128370 missense probably damaging 1.00
R7367:Hsd17b4 UTSW 18 50155185 missense probably damaging 1.00
R7397:Hsd17b4 UTSW 18 50146424 missense probably damaging 1.00
R7509:Hsd17b4 UTSW 18 50164682 missense probably damaging 1.00
R7697:Hsd17b4 UTSW 18 50130141 missense probably damaging 1.00
R7722:Hsd17b4 UTSW 18 50146524 missense probably damaging 1.00
R7764:Hsd17b4 UTSW 18 50146415 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTATTATGTATGCCCTCGGAGTG -3'
(R):5'- TCGATTGGTACACTCTTCTTGG -3'

Sequencing Primer
(F):5'- TGGGAGCGTCAGTCAAAAATCC -3'
(R):5'- GGAATTTTAAACTAACTCTCCCCTC -3'
Posted On2019-09-13