Mutagenetix > Incidental Mutation

Incidental Mutation 'R7384:Adcy10'

572919

Institutional Source

Beutler Lab

Gene Symbol

Adcy10

Ensembl Gene

ENSMUSG00000026567

Gene Name

adenylate cyclase 10

Synonyms

sAC, Sacy, soluble adenylyl cyclase

MMRRC Submission

045466-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.376) question?

Stock #

R7384 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

165485183-165576774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 165576608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1611 (P1611S)

Ref Sequence

ENSEMBL: ENSMUSP00000027852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]

AlphaFold

Q8C0T9

Predicted Effect

unknown
Transcript: ENSMUST00000027852
AA Change: P1611S

SMART Domains

Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: P1611S

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	442	2.3e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	6e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111439

SMART Domains

Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111440

SMART Domains

Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000148550

SMART Domains

Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	420	4.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155216

SMART Domains

Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
PDB:4OZ3\|A	1	98	2e-51	PDB
Blast:CYCc	7	98	2e-61	BLAST
SCOP:d1azsb_	43	98	9e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,463,468		probably null	Het
Abca13	C	A	11: 9,333,257	S3226R	probably damaging	Het
Abhd14b	A	G	9: 106,450,141	I41V	probably benign	Het
Acot2	T	C	12: 83,992,667	S317P	probably benign	Het
Acp7	T	C	7: 28,615,088	E284G	possibly damaging	Het
Adamts5	A	G	16: 85,899,826	F148L	probably benign	Het
Agr2	A	G	12: 35,995,924	T57A	probably damaging	Het
Ankar	T	G	1: 72,658,465	I1060L	probably benign	Het
Ano10	T	A	9: 122,176,343	D77V	unknown	Het
Apc2	G	A	10: 80,312,624	V1171I	probably damaging	Het
Apoa4	G	A	9: 46,241,474	R19Q	not run	Het
Arhgap33	A	G	7: 30,527,271	S504P	probably damaging	Het
Atg2a	T	C	19: 6,261,677	V1862A	probably damaging	Het
Atp7b	T	C	8: 22,022,315	S511G	probably benign	Het
Bcl10	A	G	3: 145,933,040	K146E	possibly damaging	Het
Bsg	A	T	10: 79,709,797	D181V	probably damaging	Het
Btg4	T	C	9: 51,119,113	V171A	probably benign	Het
Cdh8	A	C	8: 99,230,506	N188K	probably benign	Het
Cflar	C	A	1: 58,752,576	T346K		Het
Chrna5	T	C	9: 55,004,833	S306P	probably damaging	Het
Cldn20	G	A	17: 3,532,611	G20R	probably damaging	Het
Clns1a	G	A	7: 97,696,781	A18T	probably benign	Het
D130043K22Rik	A	G	13: 24,882,605	Y795C	probably damaging	Het
Dync1li2	A	C	8: 104,442,543	S38A	probably benign	Het
Dysf	A	G	6: 84,114,105	E1043G	probably benign	Het
Eral1	A	G	11: 78,074,101	I422T	possibly damaging	Het
Exoc3	G	A	13: 74,172,156	P729S	probably benign	Het
Eya1	T	A	1: 14,229,512	Y339F	probably damaging	Het
Faah	G	T	4: 116,005,167	N206K	probably damaging	Het
Fem1a	A	G	17: 56,257,537	E210G	probably benign	Het
Gcc2	T	A	10: 58,269,964	S341T	probably damaging	Het
Gfpt2	A	T	11: 49,810,990	I123F	possibly damaging	Het
Gm21188	T	A	13: 120,035,261	Q24L	possibly damaging	Het
Gm3047	T	A	14: 4,558,271	N164K	probably damaging	Het
Gm3327	A	G	14: 44,124,877	K78E		Het
Gm438	T	A	4: 144,780,621	I65F	possibly damaging	Het
Herpud1	A	G	8: 94,389,377	I57V	probably damaging	Het
Homer1	A	T	13: 93,393,039	R285S	possibly damaging	Het
Hps6	T	A	19: 46,004,017	V131E	possibly damaging	Het
Il1r1	T	A	1: 40,282,261	I11N	possibly damaging	Het
Jakmip1	T	A	5: 37,173,207	D410E	possibly damaging	Het
Kif3a	T	A	11: 53,578,854	F97L	probably damaging	Het
Klf11	C	T	12: 24,653,743	T76I	probably damaging	Het
Ldlr	A	C	9: 21,739,794	T503P	probably benign	Het
Mapk3	G	C	7: 126,764,291	R279P		Het
Mb21d2	A	T	16: 28,828,912	D103E	probably benign	Het
Mfsd7a	A	T	5: 108,446,060	I61K	probably damaging	Het
Msh4	T	A	3: 153,888,748	M333L	probably benign	Het
Mycbp2	A	G	14: 103,276,393	I836T	probably damaging	Het
Myh1	A	T	11: 67,224,375	E1912V	possibly damaging	Het
Ncapd2	A	G	6: 125,173,401	V887A	probably benign	Het
Nlrp4a	G	A	7: 26,449,538	R190Q	not run	Het
Nop53	T	C	7: 15,939,495	T344A	probably damaging	Het
Olfr235	T	C	19: 12,269,076	V282A	possibly damaging	Het
Olfr457	A	T	6: 42,471,323	L285Q	possibly damaging	Het
Olfr871	A	G	9: 20,212,745	Y132C	probably damaging	Het
Pcyox1l	A	C	18: 61,698,390	V266G	probably damaging	Het
Pde5a	A	G	3: 122,825,000	Y654C	probably damaging	Het
Polq	T	C	16: 37,029,418	S345P	probably damaging	Het
Prdm1	A	T	10: 44,458,507	C8S	probably benign	Het
Psg17	T	A	7: 18,818,660	Q230L	possibly damaging	Het
Rab11fip5	A	T	6: 85,348,330	S332T	possibly damaging	Het
Rac2	T	A	15: 78,561,931	K186*	probably null	Het
S100pbp	T	C	4: 129,181,909	N208D	probably benign	Het
Scaf11	A	T	15: 96,420,387	V432D	possibly damaging	Het
Slc34a1	G	T	13: 55,402,934	C225F	probably benign	Het
Slc35e2	A	T	4: 155,610,632	M152L	probably benign	Het
Slc9a4	T	A	1: 40,612,251	I563K	probably benign	Het
Sppl3	T	G	5: 115,061,641		probably null	Het
Stam	T	C	2: 14,134,430	F301L	probably benign	Het
Supt16	G	A	14: 52,181,162	R213W	probably damaging	Het
Tbc1d8	A	T	1: 39,394,098	D334E	probably benign	Het
Tmem87a	C	T	2: 120,371,523		probably null	Het
Tnk1	T	C	11: 69,851,621	Y661C	probably damaging	Het
Tnpo2	G	A	8: 85,050,119	R485H	probably damaging	Het
Tnxb	A	G	17: 34,718,518	D2947G	probably damaging	Het
Traf4	A	G	11: 78,160,791		probably null	Het
Trappc10	A	T	10: 78,209,384	M490K	possibly damaging	Het
Trav12-1	A	G	14: 53,538,536	T49A	probably benign	Het
Ttc37	A	C	13: 76,150,735	S1187R	possibly damaging	Het
Twistnb	G	T	12: 33,433,632	G128W	probably damaging	Het
Ubap1l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	9: 65,371,750		probably benign	Het
Unc79	G	T	12: 103,171,578	V2485L	probably benign	Het
Ush2a	T	C	1: 188,400,163	S861P	probably damaging	Het
Vcam1	A	G	3: 116,117,228	V507A	possibly damaging	Het
Vmn1r218	A	G	13: 23,136,725	M81V	probably benign	Het
Zfp652	G	T	11: 95,753,004	V343L	probably damaging	Het

Other mutations in Adcy10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Adcy10	APN	1	165551914	missense	probably benign	0.45
IGL00731:Adcy10	APN	1	165572614	missense	probably benign
IGL01099:Adcy10	APN	1	165539842	missense	probably benign	0.21
IGL01464:Adcy10	APN	1	165546587	missense	probably damaging	1.00
IGL01729:Adcy10	APN	1	165513168	critical splice donor site	probably null
IGL02002:Adcy10	APN	1	165521843	missense	probably damaging	1.00
IGL02094:Adcy10	APN	1	165570620	missense	probably damaging	1.00
IGL02132:Adcy10	APN	1	165572543	missense	probably damaging	0.96
IGL02276:Adcy10	APN	1	165559128	missense	probably damaging	0.96
IGL02408:Adcy10	APN	1	165538380	missense	probably damaging	1.00
IGL02410:Adcy10	APN	1	165510408	missense	probably damaging	1.00
IGL02445:Adcy10	APN	1	165570744	missense	possibly damaging	0.85
IGL02470:Adcy10	APN	1	165567726	missense	probably damaging	1.00
IGL02551:Adcy10	APN	1	165543233	missense	probably damaging	1.00
IGL02606:Adcy10	APN	1	165519518	missense	possibly damaging	0.88
IGL02609:Adcy10	APN	1	165538475	nonsense	probably null
Bugged	UTSW	1	165564237	missense	probably damaging	0.99
debye	UTSW	1	165551361	critical splice donor site	probably null
malaysian	UTSW	1	165513127	missense	probably benign	0.38
singaporean	UTSW	1	165518312	missense	probably damaging	0.98
PIT4514001:Adcy10	UTSW	1	165556791	missense	probably benign	0.28
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0276:Adcy10	UTSW	1	165572591	missense	possibly damaging	0.88
R0324:Adcy10	UTSW	1	165564249	missense	probably benign	0.00
R0433:Adcy10	UTSW	1	165552022	missense	probably damaging	1.00
R0454:Adcy10	UTSW	1	165570728	missense	probably damaging	1.00
R0501:Adcy10	UTSW	1	165510390	missense	probably damaging	1.00
R0513:Adcy10	UTSW	1	165519519	missense	probably benign	0.04
R0533:Adcy10	UTSW	1	165564023	missense	probably benign	0.05
R0550:Adcy10	UTSW	1	165565315	missense	probably benign	0.00
R0554:Adcy10	UTSW	1	165513130	missense	probably benign
R0597:Adcy10	UTSW	1	165525062	critical splice donor site	probably null
R0629:Adcy10	UTSW	1	165543105	missense	probably damaging	1.00
R1421:Adcy10	UTSW	1	165563947	missense	probably damaging	0.98
R1454:Adcy10	UTSW	1	165515380	missense	possibly damaging	0.66
R1524:Adcy10	UTSW	1	165518403	missense	probably damaging	1.00
R1534:Adcy10	UTSW	1	165518312	missense	probably damaging	0.98
R1594:Adcy10	UTSW	1	165525033	missense	probably benign	0.02
R1690:Adcy10	UTSW	1	165519925	missense	probably damaging	1.00
R1842:Adcy10	UTSW	1	165503243	missense	probably damaging	1.00
R1859:Adcy10	UTSW	1	165521961	missense	probably damaging	1.00
R1885:Adcy10	UTSW	1	165570808	missense	probably benign	0.02
R1929:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2005:Adcy10	UTSW	1	165525022	missense	probably benign	0.02
R2211:Adcy10	UTSW	1	165518212	missense	probably damaging	1.00
R2225:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2227:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2272:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2421:Adcy10	UTSW	1	165558597	missense	probably damaging	0.97
R3614:Adcy10	UTSW	1	165575727	missense	probably benign	0.38
R4538:Adcy10	UTSW	1	165513127	missense	probably benign	0.38
R4644:Adcy10	UTSW	1	165551361	critical splice donor site	probably null
R4649:Adcy10	UTSW	1	165504049	missense	probably damaging	1.00
R4832:Adcy10	UTSW	1	165506644	missense	probably damaging	1.00
R4853:Adcy10	UTSW	1	165548213	missense	probably benign
R4916:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R4951:Adcy10	UTSW	1	165563963	missense	probably damaging	1.00
R4972:Adcy10	UTSW	1	165556862	missense	probably damaging	1.00
R5116:Adcy10	UTSW	1	165519500	missense	probably damaging	1.00
R5377:Adcy10	UTSW	1	165519895	missense	probably damaging	1.00
R5442:Adcy10	UTSW	1	165513140	missense	probably benign	0.43
R5692:Adcy10	UTSW	1	165515306	missense	probably benign	0.36
R5949:Adcy10	UTSW	1	165539817	missense	possibly damaging	0.79
R5998:Adcy10	UTSW	1	165541649	missense	probably benign	0.19
R6238:Adcy10	UTSW	1	165575728	nonsense	probably null
R6455:Adcy10	UTSW	1	165518374	missense	probably damaging	1.00
R6920:Adcy10	UTSW	1	165575658	missense	probably damaging	1.00
R6935:Adcy10	UTSW	1	165506635	missense	probably benign	0.21
R6957:Adcy10	UTSW	1	165564285	missense	probably damaging	1.00
R6970:Adcy10	UTSW	1	165556916	missense	probably benign	0.02
R7027:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R7049:Adcy10	UTSW	1	165539874	missense	probably damaging	1.00
R7062:Adcy10	UTSW	1	165538522	missense	probably benign	0.27
R7130:Adcy10	UTSW	1	165504047	missense	probably damaging	1.00
R7144:Adcy10	UTSW	1	165510370	missense	probably benign	0.01
R7182:Adcy10	UTSW	1	165543470	splice site	probably null
R7228:Adcy10	UTSW	1	165510272	missense	probably damaging	1.00
R7561:Adcy10	UTSW	1	165559172	missense	possibly damaging	0.94
R7603:Adcy10	UTSW	1	165564237	missense	probably damaging	0.99
R7693:Adcy10	UTSW	1	165570771	missense	probably benign	0.01
R7812:Adcy10	UTSW	1	165515369	missense	probably damaging	1.00
R7905:Adcy10	UTSW	1	165513168	critical splice donor site	probably null
R8040:Adcy10	UTSW	1	165552024	missense	probably damaging	1.00
R8242:Adcy10	UTSW	1	165546549	missense	possibly damaging	0.82
R8278:Adcy10	UTSW	1	165503288	missense	probably damaging	1.00
R8282:Adcy10	UTSW	1	165510337	missense	probably benign	0.34
R8812:Adcy10	UTSW	1	165551298	missense	probably damaging	0.98
R9039:Adcy10	UTSW	1	165518345	missense	probably damaging	1.00
R9178:Adcy10	UTSW	1	165575649	missense	possibly damaging	0.79
R9244:Adcy10	UTSW	1	165543110	missense	probably benign	0.00
R9712:Adcy10	UTSW	1	165513112	missense	probably damaging	1.00
RF018:Adcy10	UTSW	1	165552109	missense	probably damaging	1.00
Z1177:Adcy10	UTSW	1	165510276	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CGCCTTGTATTGCAACTGACTG -3'
(R):5'- CTTAGAGCATGTAGAAAGATAGCCAC -3'

Sequencing Primer
(F):5'- GTATTGCAACTGACTGCTTTCTAG -3'
(R):5'- GCTGGCACAGACAACTTT -3'

Posted On

2019-09-13