Incidental Mutation 'R0647:Wdfy4'
ID57293
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 038832-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0647 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33109699 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 857 (C857R)
Ref Sequence ENSEMBL: ENSMUSP00000057556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061753
AA Change: C857R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: C857R

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130509
AA Change: C857R

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: C857R

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T A 14: 8,536,655 D184V possibly damaging Het
Adamts2 C A 11: 50,603,438 T113K probably damaging Het
Adgre1 T A 17: 57,411,003 N338K probably damaging Het
Aggf1 A T 13: 95,371,656 probably null Het
Apc2 A T 10: 80,304,928 I206F probably damaging Het
Carmil3 T C 14: 55,502,435 probably null Het
Ccdc110 A C 8: 45,943,388 E772A probably damaging Het
Cdh23 A G 10: 60,307,902 F2977L probably damaging Het
Cdh23 A T 10: 60,323,374 Y2207* probably null Het
Chd4 T A 6: 125,109,123 N908K probably damaging Het
Chst9 A G 18: 15,452,669 I279T probably damaging Het
Ctnna3 A T 10: 63,820,424 N261I probably benign Het
Dlgap2 A T 8: 14,727,591 S279C possibly damaging Het
Dock4 G A 12: 40,710,884 E524K probably damaging Het
Fabp12 T A 3: 10,246,036 N122I possibly damaging Het
Fam184b T C 5: 45,584,590 T100A probably benign Het
Fbxl5 T C 5: 43,768,069 D176G probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Foxe1 A G 4: 46,344,477 N95S possibly damaging Het
Frem3 A G 8: 80,615,185 E1369G probably damaging Het
Frmpd4 C T X: 167,489,010 E483K probably damaging Het
Gbp11 T C 5: 105,330,964 K203E possibly damaging Het
Gm10334 A T 6: 41,443,341 F150L probably benign Het
Hs3st6 C T 17: 24,758,160 R205C probably damaging Het
Ifitm10 C T 7: 142,356,035 S179N probably damaging Het
Irx2 A C 13: 72,630,680 N121T probably damaging Het
Itih1 A T 14: 30,935,863 V417E probably damaging Het
Itpr1 A C 6: 108,383,698 E695A probably damaging Het
Kif1c T A 11: 70,726,141 I755K probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Lrp1 G C 10: 127,571,477 T1865R probably damaging Het
Lrrc8b T A 5: 105,480,607 I273K possibly damaging Het
Ly9 T C 1: 171,599,808 Y393C probably damaging Het
Mphosph8 T C 14: 56,674,405 V295A probably benign Het
Nlrp5 T A 7: 23,417,707 D269E probably damaging Het
Olfr1294 A G 2: 111,537,359 V310A probably benign Het
Olfr398 G A 11: 73,983,771 A279V probably damaging Het
Olfr469 T A 7: 107,823,011 I153F probably benign Het
Olfr654 T G 7: 104,588,115 F104V probably damaging Het
Olfr720 T G 14: 14,175,858 T75P probably benign Het
Otud3 A G 4: 138,913,637 L64P probably damaging Het
Pcdh17 A T 14: 84,447,773 H560L possibly damaging Het
Pcdhb21 T C 18: 37,513,860 V14A probably damaging Het
Rbfox1 A T 16: 7,224,384 Q14L probably damaging Het
Rbm44 A G 1: 91,156,928 D665G probably benign Het
Rc3h2 C T 2: 37,409,530 V163M probably damaging Het
Sash1 T A 10: 8,729,552 R1025W probably damaging Het
Sgpl1 A G 10: 61,113,488 S146P probably damaging Het
Slc27a2 G A 2: 126,587,916 D615N probably benign Het
Smap1 A G 1: 23,853,478 I135T probably damaging Het
Snapc3 A G 4: 83,450,229 D321G probably damaging Het
St6galnac4 C T 2: 32,589,448 R6C probably damaging Het
Syne2 C T 12: 75,888,203 P153L probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Tmem94 A G 11: 115,796,795 N1160S probably damaging Het
Trim65 G A 11: 116,128,210 R168C possibly damaging Het
Txndc16 A T 14: 45,169,275 I241N probably damaging Het
Txndc16 T A 14: 45,165,361 R101* probably null Het
Ugt2b38 A G 5: 87,423,469 S235P probably benign Het
Ugt3a1 A T 15: 9,310,549 M306L probably benign Het
Vmn1r23 T A 6: 57,926,184 Y203F probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Zfp493 A C 13: 67,783,875 K31T possibly damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
Dollar UTSW 14 33020311 missense probably damaging 1.00
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTACCTTAGCACATCTGGCTC -3'
(R):5'- GCGACCAATTCAGAAAGTGTCCCC -3'

Sequencing Primer
(F):5'- AGCACATCTGGCTCTATGGC -3'
(R):5'- GGTTCCAACATCACATTTCTGAGG -3'
Posted On2013-07-11