Incidental Mutation 'R7384:Slc35e2'
ID572931
Institutional Source Beutler Lab
Gene Symbol Slc35e2
Ensembl Gene ENSMUSG00000042202
Gene Namesolute carrier family 35, member E2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155601416-155623340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155610632 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 152 (M152L)
Ref Sequence ENSEMBL: ENSMUSP00000041449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043829] [ENSMUST00000105608] [ENSMUST00000115821] [ENSMUST00000118607]
Predicted Effect probably benign
Transcript: ENSMUST00000043829
AA Change: M152L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000041449
Gene: ENSMUSG00000042202
AA Change: M152L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:TPT 73 368 7.9e-93 PFAM
Pfam:UAA 74 371 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105608
AA Change: M152L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101233
Gene: ENSMUSG00000042202
AA Change: M152L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118607
AA Change: M152L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113189
Gene: ENSMUSG00000042202
AA Change: M152L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Slc35e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Slc35e2 APN 4 155612730 missense probably benign
IGL02244:Slc35e2 APN 4 155618562 missense probably damaging 0.97
R1774:Slc35e2 UTSW 4 155610164 missense possibly damaging 0.51
R1856:Slc35e2 UTSW 4 155611729 missense probably damaging 1.00
R4600:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4601:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4603:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4610:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4917:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R4918:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R5440:Slc35e2 UTSW 4 155610026 missense probably benign
R5468:Slc35e2 UTSW 4 155610026 missense probably benign
R5469:Slc35e2 UTSW 4 155610026 missense probably benign
R5470:Slc35e2 UTSW 4 155610026 missense probably benign
R5512:Slc35e2 UTSW 4 155610026 missense probably benign
R5513:Slc35e2 UTSW 4 155610026 missense probably benign
R5514:Slc35e2 UTSW 4 155610026 missense probably benign
R5689:Slc35e2 UTSW 4 155610026 missense probably benign
R5692:Slc35e2 UTSW 4 155610026 missense probably benign
R5711:Slc35e2 UTSW 4 155610026 missense probably benign
R5714:Slc35e2 UTSW 4 155610026 missense probably benign
R5799:Slc35e2 UTSW 4 155610026 missense probably benign
R5872:Slc35e2 UTSW 4 155612680 missense probably damaging 1.00
R5925:Slc35e2 UTSW 4 155611627 missense probably damaging 1.00
R5947:Slc35e2 UTSW 4 155611714 missense possibly damaging 0.70
R6044:Slc35e2 UTSW 4 155610026 missense probably benign
R6063:Slc35e2 UTSW 4 155610026 missense probably benign
R6065:Slc35e2 UTSW 4 155610026 missense probably benign
R6066:Slc35e2 UTSW 4 155610026 missense probably benign
R6188:Slc35e2 UTSW 4 155610026 missense probably benign
R6243:Slc35e2 UTSW 4 155610026 missense probably benign
R6273:Slc35e2 UTSW 4 155610026 missense probably benign
R6484:Slc35e2 UTSW 4 155612647 missense probably damaging 0.99
R6867:Slc35e2 UTSW 4 155618700 missense probably benign 0.00
R7143:Slc35e2 UTSW 4 155618594 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTCGTTCTCAGCTTGGCC -3'
(R):5'- GGCTTCCAATAAGGTTTCCATACTTAG -3'

Sequencing Primer
(F):5'- TCAGCTTGGCCTCATGC -3'
(R):5'- GAAGGTCCGGAGTTCAAATCCC -3'
Posted On2019-09-13