Incidental Mutation 'R7384:Mapk3'
ID572945
Institutional Source Beutler Lab
Gene Symbol Mapk3
Ensembl Gene ENSMUSG00000063065
Gene Namemitogen-activated protein kinase 3
Synonymsp44erk1, p44mapk, Prkm3, p44 MAP kinase, Mtap2k, Erk1, Esrk1, Erk-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126759601-126765819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 126764291 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 279 (R279P)
Ref Sequence ENSEMBL: ENSMUSP00000051619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032944] [ENSMUST00000050201] [ENSMUST00000057669] [ENSMUST00000091328]
Predicted Effect probably benign
Transcript: ENSMUST00000032944
SMART Domains Protein: ENSMUSP00000032944
Gene: ENSMUSG00000030703

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:GDPD 44 202 1.1e-23 PFAM
low complexity region 208 216 N/A INTRINSIC
low complexity region 311 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050201
AA Change: R279P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101969
Gene: ENSMUSG00000063065
AA Change: R279P

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000051619
Gene: ENSMUSG00000063065
AA Change: R279P

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Blast:S_TKc 335 372 1e-15 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000088880
Gene: ENSMUSG00000063065
AA Change: R164P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 213 2.5e-24 PFAM
Pfam:Pkinase 1 216 2.2e-58 PFAM
Pfam:APH 17 108 7.6e-7 PFAM
Blast:S_TKc 220 257 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000205657
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are hyperactive with impaired T cell maturation and proliferation. Mice homozygous for a knock-out allele on a CD-1 background exhibit normal Mendelian ratios, growth, and no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Mapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mapk3 APN 7 126764774 nonsense probably null
IGL02412:Mapk3 APN 7 126763038 nonsense probably null
wabasha UTSW 7 126763512 nonsense probably null
R0078:Mapk3 UTSW 7 126759805 missense probably damaging 1.00
R0532:Mapk3 UTSW 7 126763386 intron probably benign
R1549:Mapk3 UTSW 7 126763512 nonsense probably null
R2913:Mapk3 UTSW 7 126760806 nonsense probably null
R5220:Mapk3 UTSW 7 126764236 missense probably benign
R5408:Mapk3 UTSW 7 126763835 missense probably damaging 1.00
R5729:Mapk3 UTSW 7 126764807 missense probably benign 0.01
R5929:Mapk3 UTSW 7 126759858 unclassified probably benign
R6307:Mapk3 UTSW 7 126764282 missense probably benign 0.03
R6359:Mapk3 UTSW 7 126760756 missense probably benign
R7356:Mapk3 UTSW 7 126760915 critical splice donor site probably null
R7380:Mapk3 UTSW 7 126764795 missense
X0017:Mapk3 UTSW 7 126764248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGACTGCAGCCAGAGTCTG -3'
(R):5'- GAATCCCATGGACATCCCTTG -3'

Sequencing Primer
(F):5'- AGCCAGAGTCTGAGCCCAG -3'
(R):5'- ACATCCCTTGTCCAGTGCCTG -3'
Posted On2019-09-13