Incidental Mutation 'R7384:Cdh8'
ID572949
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
Synonymscad8
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 99230506 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 188 (N188K)
Ref Sequence ENSEMBL: ENSMUSP00000117326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000142475] [ENSMUST00000145601] [ENSMUST00000155527]
PDB Structure Crystal Structure of Cadherin8 EC1 domain [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-8 EC1-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000093249
AA Change: N188K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128860
AA Change: N188K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142129
AA Change: N188K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142475
AA Change: N188K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115977
Gene: ENSMUSG00000036510
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
Pfam:Cadherin 172 242 2.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145601
AA Change: N188K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155527
AA Change: N188K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1717:Cdh8 UTSW 8 99030705 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99190462 splice site probably null
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4666:Cdh8 UTSW 8 99024902 missense possibly damaging 0.71
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R5686:Cdh8 UTSW 8 99033222 missense probably benign 0.00
R6311:Cdh8 UTSW 8 99400895 missense probably damaging 0.99
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
R7112:Cdh8 UTSW 8 99196352 missense probably damaging 1.00
R7181:Cdh8 UTSW 8 99098925 missense probably benign
R7400:Cdh8 UTSW 8 99279560 missense probably damaging 1.00
R7537:Cdh8 UTSW 8 99098885 nonsense probably null
R7763:Cdh8 UTSW 8 99279674 nonsense probably null
R8130:Cdh8 UTSW 8 99031044 missense probably damaging 0.98
R8215:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R8314:Cdh8 UTSW 8 99171379 missense probably damaging 1.00
R8443:Cdh8 UTSW 8 99031040 missense possibly damaging 0.56
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Z1176:Cdh8 UTSW 8 99171323 missense probably benign 0.02
Z1176:Cdh8 UTSW 8 99190205 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- CTCACAGTGTGCCATCAAAC -3'
(R):5'- TAACAAAGCAGTTTGCCTCCAC -3'

Sequencing Primer
(F):5'- CACAGTGTGCCATCAAACATTTTTGG -3'
(R):5'- AAGCAGTTTGCCTCCACATTTAGG -3'
Posted On2019-09-13