Incidental Mutation 'R7384:Ldlr'
ID 572952
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Name low density lipoprotein receptor
Synonyms
MMRRC Submission 045466-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7384 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21634872-21661215 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21651090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 503 (T503P)
Ref Sequence ENSEMBL: ENSMUSP00000034713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
AlphaFold P35951
Predicted Effect probably benign
Transcript: ENSMUST00000034713
AA Change: T503P

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: T503P

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213114
AA Change: T503P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,507,191 (GRCm39) I65F possibly damaging Het
Abca13 C A 11: 9,283,257 (GRCm39) S3226R probably damaging Het
Abhd14b A G 9: 106,327,340 (GRCm39) I41V probably benign Het
Acot2 T C 12: 84,039,441 (GRCm39) S317P probably benign Het
Acp7 T C 7: 28,314,513 (GRCm39) E284G possibly damaging Het
Adamts5 A G 16: 85,696,714 (GRCm39) F148L probably benign Het
Adcy10 C T 1: 165,404,177 (GRCm39) P1611S unknown Het
Agr2 A G 12: 36,045,923 (GRCm39) T57A probably damaging Het
Ankar T G 1: 72,697,624 (GRCm39) I1060L probably benign Het
Ano10 T A 9: 122,005,409 (GRCm39) D77V unknown Het
Anxa2r1 T A 13: 120,496,797 (GRCm39) Q24L possibly damaging Het
Apc2 G A 10: 80,148,458 (GRCm39) V1171I probably damaging Het
Apoa4 G A 9: 46,152,772 (GRCm39) R19Q not run Het
Arhgap33 A G 7: 30,226,696 (GRCm39) S504P probably damaging Het
Atg2a T C 19: 6,311,707 (GRCm39) V1862A probably damaging Het
Atp7b T C 8: 22,512,331 (GRCm39) S511G probably benign Het
Bcl10 A G 3: 145,638,795 (GRCm39) K146E possibly damaging Het
Bsg A T 10: 79,545,631 (GRCm39) D181V probably damaging Het
Btg4 T C 9: 51,030,413 (GRCm39) V171A probably benign Het
Cdh8 A C 8: 99,957,138 (GRCm39) N188K probably benign Het
Cflar C A 1: 58,791,735 (GRCm39) T346K Het
Chrna5 T C 9: 54,912,117 (GRCm39) S306P probably damaging Het
Cldn20 G A 17: 3,582,886 (GRCm39) G20R probably damaging Het
Clns1a G A 7: 97,345,988 (GRCm39) A18T probably benign Het
D130043K22Rik A G 13: 25,066,588 (GRCm39) Y795C probably damaging Het
Dync1li2 A C 8: 105,169,175 (GRCm39) S38A probably benign Het
Dysf A G 6: 84,091,087 (GRCm39) E1043G probably benign Het
Elapor1 A T 3: 108,370,784 (GRCm39) probably null Het
Eral1 A G 11: 77,964,927 (GRCm39) I422T possibly damaging Het
Exoc3 G A 13: 74,320,275 (GRCm39) P729S probably benign Het
Eya1 T A 1: 14,299,736 (GRCm39) Y339F probably damaging Het
Faah G T 4: 115,862,364 (GRCm39) N206K probably damaging Het
Fem1a A G 17: 56,564,537 (GRCm39) E210G probably benign Het
Gcc2 T A 10: 58,105,786 (GRCm39) S341T probably damaging Het
Gfpt2 A T 11: 49,701,817 (GRCm39) I123F possibly damaging Het
Gm3047 T A 14: 4,558,271 (GRCm38) N164K probably damaging Het
Gm3327 A G 14: 44,362,334 (GRCm39) K78E Het
Herpud1 A G 8: 95,116,005 (GRCm39) I57V probably damaging Het
Homer1 A T 13: 93,529,547 (GRCm39) R285S possibly damaging Het
Hps6 T A 19: 45,992,456 (GRCm39) V131E possibly damaging Het
Il1r1 T A 1: 40,321,421 (GRCm39) I11N possibly damaging Het
Jakmip1 T A 5: 37,330,551 (GRCm39) D410E possibly damaging Het
Kif3a T A 11: 53,469,681 (GRCm39) F97L probably damaging Het
Klf11 C T 12: 24,703,742 (GRCm39) T76I probably damaging Het
Mapk3 G C 7: 126,363,463 (GRCm39) R279P Het
Mb21d2 A T 16: 28,647,664 (GRCm39) D103E probably benign Het
Msh4 T A 3: 153,594,385 (GRCm39) M333L probably benign Het
Mycbp2 A G 14: 103,513,829 (GRCm39) I836T probably damaging Het
Myh1 A T 11: 67,115,201 (GRCm39) E1912V possibly damaging Het
Ncapd2 A G 6: 125,150,364 (GRCm39) V887A probably benign Het
Nlrp4a G A 7: 26,148,963 (GRCm39) R190Q not run Het
Nop53 T C 7: 15,673,420 (GRCm39) T344A probably damaging Het
Or2r3 A T 6: 42,448,257 (GRCm39) L285Q possibly damaging Het
Or5an11 T C 19: 12,246,440 (GRCm39) V282A possibly damaging Het
Or7h8 A G 9: 20,124,041 (GRCm39) Y132C probably damaging Het
Pcyox1l A C 18: 61,831,461 (GRCm39) V266G probably damaging Het
Pde5a A G 3: 122,618,649 (GRCm39) Y654C probably damaging Het
Polq T C 16: 36,849,780 (GRCm39) S345P probably damaging Het
Polr1f G T 12: 33,483,631 (GRCm39) G128W probably damaging Het
Prdm1 A T 10: 44,334,503 (GRCm39) C8S probably benign Het
Psg17 T A 7: 18,552,585 (GRCm39) Q230L possibly damaging Het
Rab11fip5 A T 6: 85,325,312 (GRCm39) S332T possibly damaging Het
Rac2 T A 15: 78,446,131 (GRCm39) K186* probably null Het
S100pbp T C 4: 129,075,702 (GRCm39) N208D probably benign Het
Scaf11 A T 15: 96,318,268 (GRCm39) V432D possibly damaging Het
Skic3 A C 13: 76,298,854 (GRCm39) S1187R possibly damaging Het
Slc34a1 G T 13: 55,550,747 (GRCm39) C225F probably benign Het
Slc35e2 A T 4: 155,695,089 (GRCm39) M152L probably benign Het
Slc49a3 A T 5: 108,593,926 (GRCm39) I61K probably damaging Het
Slc9a4 T A 1: 40,651,411 (GRCm39) I563K probably benign Het
Sppl3 T G 5: 115,199,700 (GRCm39) probably null Het
Stam T C 2: 14,139,241 (GRCm39) F301L probably benign Het
Supt16 G A 14: 52,418,619 (GRCm39) R213W probably damaging Het
Tbc1d8 A T 1: 39,433,179 (GRCm39) D334E probably benign Het
Tmem87a C T 2: 120,202,004 (GRCm39) probably null Het
Tnk1 T C 11: 69,742,447 (GRCm39) Y661C probably damaging Het
Tnpo2 G A 8: 85,776,748 (GRCm39) R485H probably damaging Het
Tnxb A G 17: 34,937,492 (GRCm39) D2947G probably damaging Het
Traf4 A G 11: 78,051,617 (GRCm39) probably null Het
Trappc10 A T 10: 78,045,218 (GRCm39) M490K possibly damaging Het
Trav12-1 A G 14: 53,775,993 (GRCm39) T49A probably benign Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,279,032 (GRCm39) probably benign Het
Unc79 G T 12: 103,137,837 (GRCm39) V2485L probably benign Het
Ush2a T C 1: 188,132,360 (GRCm39) S861P probably damaging Het
Vcam1 A G 3: 115,910,877 (GRCm39) V507A possibly damaging Het
Vmn1r218 A G 13: 23,320,895 (GRCm39) M81V probably benign Het
Zfp652 G T 11: 95,643,830 (GRCm39) V343L probably damaging Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21,646,657 (GRCm39) critical splice donor site probably null
IGL01975:Ldlr APN 9 21,644,993 (GRCm39) missense probably benign 0.05
IGL02043:Ldlr APN 9 21,644,795 (GRCm39) missense probably benign 0.03
IGL02524:Ldlr APN 9 21,644,977 (GRCm39) missense probably damaging 1.00
IGL03049:Ldlr APN 9 21,657,115 (GRCm39) missense probably benign 0.00
IGL03113:Ldlr APN 9 21,651,124 (GRCm39) missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21,649,295 (GRCm39) splice site probably benign
R0586:Ldlr UTSW 9 21,651,040 (GRCm39) missense probably benign 0.00
R1398:Ldlr UTSW 9 21,650,838 (GRCm39) missense probably benign 0.01
R1587:Ldlr UTSW 9 21,649,209 (GRCm39) missense probably damaging 0.99
R2198:Ldlr UTSW 9 21,643,698 (GRCm39) missense probably damaging 1.00
R3730:Ldlr UTSW 9 21,643,097 (GRCm39) missense probably benign 0.09
R4422:Ldlr UTSW 9 21,649,248 (GRCm39) missense probably damaging 1.00
R5044:Ldlr UTSW 9 21,646,538 (GRCm39) missense probably benign 0.00
R5046:Ldlr UTSW 9 21,657,203 (GRCm39) critical splice donor site probably null
R6186:Ldlr UTSW 9 21,635,055 (GRCm39) start gained probably benign
R6195:Ldlr UTSW 9 21,643,077 (GRCm39) nonsense probably null
R6523:Ldlr UTSW 9 21,648,549 (GRCm39) missense probably damaging 1.00
R6682:Ldlr UTSW 9 21,643,671 (GRCm39) missense probably benign
R7256:Ldlr UTSW 9 21,657,040 (GRCm39) missense probably benign 0.01
R7823:Ldlr UTSW 9 21,653,602 (GRCm39) critical splice donor site probably null
R8065:Ldlr UTSW 9 21,649,241 (GRCm39) missense probably damaging 1.00
R8223:Ldlr UTSW 9 21,658,546 (GRCm39) missense probably damaging 1.00
R8732:Ldlr UTSW 9 21,650,985 (GRCm39) missense probably benign 0.00
R8931:Ldlr UTSW 9 21,643,108 (GRCm39) missense probably damaging 0.99
R8954:Ldlr UTSW 9 21,650,828 (GRCm39) missense possibly damaging 0.87
R9315:Ldlr UTSW 9 21,644,782 (GRCm39) splice site probably benign
R9489:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9517:Ldlr UTSW 9 21,655,240 (GRCm39) missense possibly damaging 0.90
R9605:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9709:Ldlr UTSW 9 21,657,135 (GRCm39) missense probably benign 0.00
X0024:Ldlr UTSW 9 21,651,114 (GRCm39) missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21,651,126 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATCTACAGGTGAGCTGC -3'
(R):5'- TGAGCTCAGGACCATCTCAC -3'

Sequencing Primer
(F):5'- GACCCCAGGCTCTATTGTGAC -3'
(R):5'- AGGACCATCTCACATTCTCCTGAG -3'
Posted On 2019-09-13