Incidental Mutation 'R7384:Myh1'
ID572967
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67224375 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1912 (E1912V)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018637
AA Change: E1912V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: E1912V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075734
AA Change: E1912V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: E1912V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124516
AA Change: E1912V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: E1912V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
R8080:Myh1 UTSW 11 67211402 missense probably benign 0.10
R8117:Myh1 UTSW 11 67222205 missense probably damaging 1.00
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCATGAAGTATATGCGGAG -3'
(R):5'- GAAGAGACTGACGAGCTCTTGG -3'

Sequencing Primer
(F):5'- AAATGTACACACTTGTCTACACTTC -3'
(R):5'- TCTCCCAAAGTTATGAGTACAAAAC -3'
Posted On2019-09-13