Incidental Mutation 'R7384:Myh1'
ID 572967
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Name myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms MYHC-IIX, IId, IId/x, myosin heavy chain 2X, A530084A17Rik, MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2
MMRRC Submission 045466-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7384 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67090922-67115401 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67115201 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 1912 (E1912V)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
AlphaFold Q5SX40
Predicted Effect possibly damaging
Transcript: ENSMUST00000018637
AA Change: E1912V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: E1912V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075734
AA Change: E1912V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: E1912V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124516
AA Change: E1912V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: E1912V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,507,191 (GRCm39) I65F possibly damaging Het
Abca13 C A 11: 9,283,257 (GRCm39) S3226R probably damaging Het
Abhd14b A G 9: 106,327,340 (GRCm39) I41V probably benign Het
Acot2 T C 12: 84,039,441 (GRCm39) S317P probably benign Het
Acp7 T C 7: 28,314,513 (GRCm39) E284G possibly damaging Het
Adamts5 A G 16: 85,696,714 (GRCm39) F148L probably benign Het
Adcy10 C T 1: 165,404,177 (GRCm39) P1611S unknown Het
Agr2 A G 12: 36,045,923 (GRCm39) T57A probably damaging Het
Ankar T G 1: 72,697,624 (GRCm39) I1060L probably benign Het
Ano10 T A 9: 122,005,409 (GRCm39) D77V unknown Het
Anxa2r1 T A 13: 120,496,797 (GRCm39) Q24L possibly damaging Het
Apc2 G A 10: 80,148,458 (GRCm39) V1171I probably damaging Het
Apoa4 G A 9: 46,152,772 (GRCm39) R19Q not run Het
Arhgap33 A G 7: 30,226,696 (GRCm39) S504P probably damaging Het
Atg2a T C 19: 6,311,707 (GRCm39) V1862A probably damaging Het
Atp7b T C 8: 22,512,331 (GRCm39) S511G probably benign Het
Bcl10 A G 3: 145,638,795 (GRCm39) K146E possibly damaging Het
Bsg A T 10: 79,545,631 (GRCm39) D181V probably damaging Het
Btg4 T C 9: 51,030,413 (GRCm39) V171A probably benign Het
Cdh8 A C 8: 99,957,138 (GRCm39) N188K probably benign Het
Cflar C A 1: 58,791,735 (GRCm39) T346K Het
Chrna5 T C 9: 54,912,117 (GRCm39) S306P probably damaging Het
Cldn20 G A 17: 3,582,886 (GRCm39) G20R probably damaging Het
Clns1a G A 7: 97,345,988 (GRCm39) A18T probably benign Het
D130043K22Rik A G 13: 25,066,588 (GRCm39) Y795C probably damaging Het
Dync1li2 A C 8: 105,169,175 (GRCm39) S38A probably benign Het
Dysf A G 6: 84,091,087 (GRCm39) E1043G probably benign Het
Elapor1 A T 3: 108,370,784 (GRCm39) probably null Het
Eral1 A G 11: 77,964,927 (GRCm39) I422T possibly damaging Het
Exoc3 G A 13: 74,320,275 (GRCm39) P729S probably benign Het
Eya1 T A 1: 14,299,736 (GRCm39) Y339F probably damaging Het
Faah G T 4: 115,862,364 (GRCm39) N206K probably damaging Het
Fem1a A G 17: 56,564,537 (GRCm39) E210G probably benign Het
Gcc2 T A 10: 58,105,786 (GRCm39) S341T probably damaging Het
Gfpt2 A T 11: 49,701,817 (GRCm39) I123F possibly damaging Het
Gm3047 T A 14: 4,558,271 (GRCm38) N164K probably damaging Het
Gm3327 A G 14: 44,362,334 (GRCm39) K78E Het
Herpud1 A G 8: 95,116,005 (GRCm39) I57V probably damaging Het
Homer1 A T 13: 93,529,547 (GRCm39) R285S possibly damaging Het
Hps6 T A 19: 45,992,456 (GRCm39) V131E possibly damaging Het
Il1r1 T A 1: 40,321,421 (GRCm39) I11N possibly damaging Het
Jakmip1 T A 5: 37,330,551 (GRCm39) D410E possibly damaging Het
Kif3a T A 11: 53,469,681 (GRCm39) F97L probably damaging Het
Klf11 C T 12: 24,703,742 (GRCm39) T76I probably damaging Het
Ldlr A C 9: 21,651,090 (GRCm39) T503P probably benign Het
Mapk3 G C 7: 126,363,463 (GRCm39) R279P Het
Mb21d2 A T 16: 28,647,664 (GRCm39) D103E probably benign Het
Msh4 T A 3: 153,594,385 (GRCm39) M333L probably benign Het
Mycbp2 A G 14: 103,513,829 (GRCm39) I836T probably damaging Het
Ncapd2 A G 6: 125,150,364 (GRCm39) V887A probably benign Het
Nlrp4a G A 7: 26,148,963 (GRCm39) R190Q not run Het
Nop53 T C 7: 15,673,420 (GRCm39) T344A probably damaging Het
Or2r3 A T 6: 42,448,257 (GRCm39) L285Q possibly damaging Het
Or5an11 T C 19: 12,246,440 (GRCm39) V282A possibly damaging Het
Or7h8 A G 9: 20,124,041 (GRCm39) Y132C probably damaging Het
Pcyox1l A C 18: 61,831,461 (GRCm39) V266G probably damaging Het
Pde5a A G 3: 122,618,649 (GRCm39) Y654C probably damaging Het
Polq T C 16: 36,849,780 (GRCm39) S345P probably damaging Het
Polr1f G T 12: 33,483,631 (GRCm39) G128W probably damaging Het
Prdm1 A T 10: 44,334,503 (GRCm39) C8S probably benign Het
Psg17 T A 7: 18,552,585 (GRCm39) Q230L possibly damaging Het
Rab11fip5 A T 6: 85,325,312 (GRCm39) S332T possibly damaging Het
Rac2 T A 15: 78,446,131 (GRCm39) K186* probably null Het
S100pbp T C 4: 129,075,702 (GRCm39) N208D probably benign Het
Scaf11 A T 15: 96,318,268 (GRCm39) V432D possibly damaging Het
Skic3 A C 13: 76,298,854 (GRCm39) S1187R possibly damaging Het
Slc34a1 G T 13: 55,550,747 (GRCm39) C225F probably benign Het
Slc35e2 A T 4: 155,695,089 (GRCm39) M152L probably benign Het
Slc49a3 A T 5: 108,593,926 (GRCm39) I61K probably damaging Het
Slc9a4 T A 1: 40,651,411 (GRCm39) I563K probably benign Het
Sppl3 T G 5: 115,199,700 (GRCm39) probably null Het
Stam T C 2: 14,139,241 (GRCm39) F301L probably benign Het
Supt16 G A 14: 52,418,619 (GRCm39) R213W probably damaging Het
Tbc1d8 A T 1: 39,433,179 (GRCm39) D334E probably benign Het
Tmem87a C T 2: 120,202,004 (GRCm39) probably null Het
Tnk1 T C 11: 69,742,447 (GRCm39) Y661C probably damaging Het
Tnpo2 G A 8: 85,776,748 (GRCm39) R485H probably damaging Het
Tnxb A G 17: 34,937,492 (GRCm39) D2947G probably damaging Het
Traf4 A G 11: 78,051,617 (GRCm39) probably null Het
Trappc10 A T 10: 78,045,218 (GRCm39) M490K possibly damaging Het
Trav12-1 A G 14: 53,775,993 (GRCm39) T49A probably benign Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,279,032 (GRCm39) probably benign Het
Unc79 G T 12: 103,137,837 (GRCm39) V2485L probably benign Het
Ush2a T C 1: 188,132,360 (GRCm39) S861P probably damaging Het
Vcam1 A G 3: 115,910,877 (GRCm39) V507A possibly damaging Het
Vmn1r218 A G 13: 23,320,895 (GRCm39) M81V probably benign Het
Zfp652 G T 11: 95,643,830 (GRCm39) V343L probably damaging Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67,111,691 (GRCm39) missense probably damaging 0.99
IGL00514:Myh1 APN 11 67,110,610 (GRCm39) missense probably damaging 1.00
IGL00851:Myh1 APN 11 67,108,736 (GRCm39) missense probably damaging 0.96
IGL01061:Myh1 APN 11 67,108,688 (GRCm39) missense probably benign 0.05
IGL01113:Myh1 APN 11 67,093,006 (GRCm39) missense probably benign 0.00
IGL01125:Myh1 APN 11 67,111,486 (GRCm39) missense probably benign
IGL01391:Myh1 APN 11 67,108,689 (GRCm39) missense probably benign 0.00
IGL01392:Myh1 APN 11 67,112,127 (GRCm39) missense probably benign 0.20
IGL01404:Myh1 APN 11 67,112,977 (GRCm39) missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67,102,238 (GRCm39) missense probably damaging 1.00
IGL01739:Myh1 APN 11 67,105,354 (GRCm39) missense probably damaging 0.99
IGL01759:Myh1 APN 11 67,110,732 (GRCm39) missense probably damaging 1.00
IGL01922:Myh1 APN 11 67,101,292 (GRCm39) critical splice donor site probably null
IGL01952:Myh1 APN 11 67,111,218 (GRCm39) splice site probably null
IGL02007:Myh1 APN 11 67,111,382 (GRCm39) missense probably benign 0.03
IGL02028:Myh1 APN 11 67,101,441 (GRCm39) missense probably damaging 1.00
IGL02245:Myh1 APN 11 67,102,313 (GRCm39) missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67,097,088 (GRCm39) unclassified probably benign
IGL02942:Myh1 APN 11 67,093,308 (GRCm39) missense probably damaging 1.00
IGL02967:Myh1 APN 11 67,099,896 (GRCm39) missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67,097,213 (GRCm39) missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67,097,351 (GRCm39) missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67,102,328 (GRCm39) missense probably benign 0.01
compelling UTSW 11 67,110,631 (GRCm39) critical splice donor site probably null
convincing UTSW 11 67,093,365 (GRCm39) missense probably damaging 1.00
muscle UTSW 11 67,096,874 (GRCm39) nonsense probably null
Persuasive UTSW 11 67,099,890 (GRCm39) missense possibly damaging 0.90
G1patch:Myh1 UTSW 11 67,092,719 (GRCm39) missense probably damaging 1.00
R0041:Myh1 UTSW 11 67,099,904 (GRCm39) missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67,104,237 (GRCm39) missense probably damaging 1.00
R0081:Myh1 UTSW 11 67,106,683 (GRCm39) missense probably benign
R0317:Myh1 UTSW 11 67,108,338 (GRCm39) missense probably damaging 1.00
R0465:Myh1 UTSW 11 67,101,243 (GRCm39) missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67,111,445 (GRCm39) missense probably damaging 1.00
R0731:Myh1 UTSW 11 67,093,359 (GRCm39) missense probably damaging 0.98
R0964:Myh1 UTSW 11 67,096,751 (GRCm39) missense probably benign
R0964:Myh1 UTSW 11 67,112,430 (GRCm39) missense probably damaging 1.00
R1427:Myh1 UTSW 11 67,110,573 (GRCm39) missense probably damaging 0.99
R1429:Myh1 UTSW 11 67,108,736 (GRCm39) missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67,096,325 (GRCm39) unclassified probably benign
R1562:Myh1 UTSW 11 67,102,196 (GRCm39) missense probably benign 0.04
R1727:Myh1 UTSW 11 67,101,292 (GRCm39) critical splice donor site probably benign
R1796:Myh1 UTSW 11 67,115,183 (GRCm39) missense probably benign 0.00
R1808:Myh1 UTSW 11 67,102,300 (GRCm39) nonsense probably null
R1836:Myh1 UTSW 11 67,095,648 (GRCm39) missense probably damaging 0.98
R1848:Myh1 UTSW 11 67,104,456 (GRCm39) missense probably benign 0.10
R1851:Myh1 UTSW 11 67,095,224 (GRCm39) missense probably damaging 1.00
R1925:Myh1 UTSW 11 67,101,996 (GRCm39) missense probably benign 0.01
R1967:Myh1 UTSW 11 67,104,273 (GRCm39) missense probably benign 0.08
R1999:Myh1 UTSW 11 67,113,234 (GRCm39) missense probably benign 0.04
R2067:Myh1 UTSW 11 67,105,446 (GRCm39) missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67,105,446 (GRCm39) missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67,113,234 (GRCm39) missense probably benign 0.04
R2189:Myh1 UTSW 11 67,112,430 (GRCm39) missense probably damaging 1.00
R2352:Myh1 UTSW 11 67,111,363 (GRCm39) missense probably benign 0.00
R2436:Myh1 UTSW 11 67,104,097 (GRCm39) missense probably benign 0.04
R2483:Myh1 UTSW 11 67,102,052 (GRCm39) missense probably benign
R2508:Myh1 UTSW 11 67,104,424 (GRCm39) missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67,096,423 (GRCm39) missense probably benign 0.01
R2511:Myh1 UTSW 11 67,096,423 (GRCm39) missense probably benign 0.01
R2908:Myh1 UTSW 11 67,111,522 (GRCm39) nonsense probably null
R2966:Myh1 UTSW 11 67,105,410 (GRCm39) missense probably damaging 1.00
R3829:Myh1 UTSW 11 67,096,423 (GRCm39) missense probably benign 0.01
R4106:Myh1 UTSW 11 67,102,403 (GRCm39) missense probably benign 0.33
R4108:Myh1 UTSW 11 67,102,403 (GRCm39) missense probably benign 0.33
R4457:Myh1 UTSW 11 67,111,441 (GRCm39) missense probably benign 0.42
R4629:Myh1 UTSW 11 67,100,119 (GRCm39) missense probably benign 0.01
R4981:Myh1 UTSW 11 67,115,300 (GRCm39) utr 3 prime probably benign
R5032:Myh1 UTSW 11 67,096,874 (GRCm39) nonsense probably null
R5239:Myh1 UTSW 11 67,106,051 (GRCm39) missense probably benign 0.19
R5241:Myh1 UTSW 11 67,095,275 (GRCm39) missense probably benign
R5303:Myh1 UTSW 11 67,092,843 (GRCm39) missense probably benign 0.09
R5666:Myh1 UTSW 11 67,112,178 (GRCm39) missense probably benign 0.30
R5717:Myh1 UTSW 11 67,099,782 (GRCm39) missense probably benign
R5761:Myh1 UTSW 11 67,110,078 (GRCm39) missense probably damaging 0.98
R5870:Myh1 UTSW 11 67,092,805 (GRCm39) missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67,102,273 (GRCm39) missense probably damaging 1.00
R6089:Myh1 UTSW 11 67,111,613 (GRCm39) splice site probably null
R6089:Myh1 UTSW 11 67,092,993 (GRCm39) splice site probably null
R6197:Myh1 UTSW 11 67,111,793 (GRCm39) missense probably benign 0.01
R6460:Myh1 UTSW 11 67,112,202 (GRCm39) missense probably benign
R6627:Myh1 UTSW 11 67,105,835 (GRCm39) missense probably damaging 1.00
R6634:Myh1 UTSW 11 67,099,890 (GRCm39) missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67,092,719 (GRCm39) missense probably damaging 1.00
R6784:Myh1 UTSW 11 67,105,396 (GRCm39) missense probably damaging 0.99
R6813:Myh1 UTSW 11 67,111,286 (GRCm39) missense probably benign 0.34
R6866:Myh1 UTSW 11 67,115,219 (GRCm39) missense probably damaging 0.99
R6997:Myh1 UTSW 11 67,111,463 (GRCm39) missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67,111,247 (GRCm39) missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67,093,412 (GRCm39) missense probably benign
R7185:Myh1 UTSW 11 67,098,285 (GRCm39) missense probably damaging 1.00
R7194:Myh1 UTSW 11 67,102,183 (GRCm39) missense probably benign
R7283:Myh1 UTSW 11 67,092,670 (GRCm39) critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67,111,435 (GRCm39) missense probably benign 0.00
R7348:Myh1 UTSW 11 67,093,365 (GRCm39) missense probably damaging 1.00
R7369:Myh1 UTSW 11 67,111,524 (GRCm39) missense probably damaging 1.00
R7375:Myh1 UTSW 11 67,101,254 (GRCm39) missense probably damaging 1.00
R7387:Myh1 UTSW 11 67,099,715 (GRCm39) missense probably benign 0.14
R7424:Myh1 UTSW 11 67,104,489 (GRCm39) missense probably damaging 1.00
R7430:Myh1 UTSW 11 67,096,393 (GRCm39) nonsense probably null
R7443:Myh1 UTSW 11 67,111,331 (GRCm39) missense probably benign
R7447:Myh1 UTSW 11 67,110,006 (GRCm39) missense probably benign 0.01
R7509:Myh1 UTSW 11 67,101,287 (GRCm39) missense probably benign 0.40
R7583:Myh1 UTSW 11 67,111,739 (GRCm39) missense probably benign 0.00
R7611:Myh1 UTSW 11 67,101,243 (GRCm39) missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67,106,701 (GRCm39) missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67,106,748 (GRCm39) missense probably benign 0.00
R8029:Myh1 UTSW 11 67,102,066 (GRCm39) critical splice donor site probably null
R8042:Myh1 UTSW 11 67,097,429 (GRCm39) missense probably damaging 1.00
R8060:Myh1 UTSW 11 67,106,077 (GRCm39) missense probably benign
R8080:Myh1 UTSW 11 67,102,228 (GRCm39) missense probably benign 0.10
R8117:Myh1 UTSW 11 67,113,031 (GRCm39) missense probably damaging 1.00
R8171:Myh1 UTSW 11 67,093,398 (GRCm39) missense probably damaging 1.00
R8183:Myh1 UTSW 11 67,092,832 (GRCm39) missense possibly damaging 0.50
R8397:Myh1 UTSW 11 67,112,465 (GRCm39) missense probably damaging 0.97
R8545:Myh1 UTSW 11 67,093,027 (GRCm39) missense probably benign 0.00
R8807:Myh1 UTSW 11 67,111,354 (GRCm39) missense probably benign 0.02
R8812:Myh1 UTSW 11 67,099,967 (GRCm39) missense probably benign 0.00
R8855:Myh1 UTSW 11 67,102,247 (GRCm39) missense probably damaging 1.00
R8906:Myh1 UTSW 11 67,096,739 (GRCm39) missense probably benign 0.02
R8959:Myh1 UTSW 11 67,102,328 (GRCm39) missense probably benign
R8992:Myh1 UTSW 11 67,096,607 (GRCm39) missense probably benign
R9140:Myh1 UTSW 11 67,100,089 (GRCm39) missense probably benign 0.04
R9293:Myh1 UTSW 11 67,099,929 (GRCm39) missense probably benign 0.25
R9366:Myh1 UTSW 11 67,110,114 (GRCm39) missense probably damaging 1.00
R9371:Myh1 UTSW 11 67,110,631 (GRCm39) critical splice donor site probably null
R9378:Myh1 UTSW 11 67,093,259 (GRCm39) missense probably damaging 0.99
R9482:Myh1 UTSW 11 67,108,745 (GRCm39) missense probably damaging 1.00
R9507:Myh1 UTSW 11 67,102,049 (GRCm39) missense probably benign 0.00
R9558:Myh1 UTSW 11 67,108,618 (GRCm39) missense possibly damaging 0.90
R9561:Myh1 UTSW 11 67,108,618 (GRCm39) missense possibly damaging 0.90
R9587:Myh1 UTSW 11 67,102,196 (GRCm39) missense probably benign 0.03
X0062:Myh1 UTSW 11 67,098,367 (GRCm39) missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67,097,144 (GRCm39) missense probably damaging 1.00
Z1187:Myh1 UTSW 11 67,095,272 (GRCm39) missense probably benign
Z1188:Myh1 UTSW 11 67,095,272 (GRCm39) missense probably benign
Z1190:Myh1 UTSW 11 67,095,272 (GRCm39) missense probably benign
Z1191:Myh1 UTSW 11 67,095,272 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGCATGAAGTATATGCGGAG -3'
(R):5'- GAAGAGACTGACGAGCTCTTGG -3'

Sequencing Primer
(F):5'- AAATGTACACACTTGTCTACACTTC -3'
(R):5'- TCTCCCAAAGTTATGAGTACAAAAC -3'
Posted On 2019-09-13