Incidental Mutation 'R7384:Tnk1'
ID572968
Institutional Source Beutler Lab
Gene Symbol Tnk1
Ensembl Gene ENSMUSG00000001583
Gene Nametyrosine kinase, non-receptor, 1
SynonymsTnk1a, Kos1, Tnk1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69851005-69858730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69851621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 661 (Y661C)
Ref Sequence ENSEMBL: ENSMUSP00000001626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108626] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000125571] [ENSMUST00000152566] [ENSMUST00000156507]
Predicted Effect probably damaging
Transcript: ENSMUST00000001626
AA Change: Y661C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583
AA Change: Y661C

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019605
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108626
SMART Domains Protein: ENSMUSP00000104266
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 6e-6 BLAST
TyrKc 116 378 1.2e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108628
AA Change: Y666C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583
AA Change: Y666C

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108632
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108633
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125571
SMART Domains Protein: ENSMUSP00000118490
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 72 2e-6 BLAST
Pfam:Pkinase 116 268 3.3e-21 PFAM
Pfam:Pkinase_Tyr 116 268 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152566
SMART Domains Protein: ENSMUSP00000123549
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 224 2.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156507
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tyrosine protein kinase family. Tyrosine protein kinases are important regulators of intracellular signal transduction pathways, mediating cellular proliferation, survival, and development. This gene is highly expressed in fetal tissues and at lower levels in few adult tissues, thus may function in signaling pathways utilized broadly during fetal development, and more selectively in adult tissues. It plays a negative regulatory role in the Ras-Raf1-MAPK pathway, and knockout mice have been shown to develop spontaneous tumors, suggesting a role as a tumor suppressor gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice either heterozygous or homozygous for a knock-out allele develop spontaneous tumors, including lymphomas and carcinomas, at high rates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Tnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Tnk1 APN 11 69855905 unclassified probably benign
IGL02668:Tnk1 APN 11 69856923 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0389:Tnk1 UTSW 11 69855682 missense probably damaging 1.00
R0529:Tnk1 UTSW 11 69855164 missense probably damaging 1.00
R1396:Tnk1 UTSW 11 69853136 missense probably benign 0.01
R1436:Tnk1 UTSW 11 69852293 splice site probably benign
R1494:Tnk1 UTSW 11 69856546 missense possibly damaging 0.60
R1687:Tnk1 UTSW 11 69856473 missense possibly damaging 0.75
R1752:Tnk1 UTSW 11 69856706 missense possibly damaging 0.92
R1832:Tnk1 UTSW 11 69856928 missense probably damaging 0.99
R2109:Tnk1 UTSW 11 69855183 missense probably damaging 1.00
R2233:Tnk1 UTSW 11 69855191 unclassified probably null
R2234:Tnk1 UTSW 11 69855191 unclassified probably null
R2423:Tnk1 UTSW 11 69855761 missense probably damaging 0.98
R3018:Tnk1 UTSW 11 69854911 intron probably benign
R3689:Tnk1 UTSW 11 69855599 missense probably damaging 1.00
R4746:Tnk1 UTSW 11 69855166 missense probably damaging 1.00
R5653:Tnk1 UTSW 11 69853585 missense probably damaging 1.00
R6154:Tnk1 UTSW 11 69856954 missense probably damaging 1.00
R7649:Tnk1 UTSW 11 69853577 splice site probably null
R7680:Tnk1 UTSW 11 69856745 missense possibly damaging 0.89
R8021:Tnk1 UTSW 11 69854984 missense probably benign 0.03
R8055:Tnk1 UTSW 11 69856501 missense probably benign 0.09
X0061:Tnk1 UTSW 11 69852272 missense probably damaging 1.00
Z1176:Tnk1 UTSW 11 69855523 missense possibly damaging 0.94
Z1177:Tnk1 UTSW 11 69855677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGGAAGCATTAGCCAGTAC -3'
(R):5'- GATGTGGCTTCTGCTATCCG -3'

Sequencing Primer
(F):5'- ATTAGCCAGTACCTGAGTGC -3'
(R):5'- TCTGCTATCCGGAACCTCAAGG -3'
Posted On2019-09-13