Incidental Mutation 'R7384:Ttc37'
ID572981
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Nametetratricopeptide repeat domain 37
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location76098734-76190316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76150735 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1187 (S1187R)
Ref Sequence ENSEMBL: ENSMUSP00000089045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091466
AA Change: S1187R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: S1187R

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224386
AA Change: S1187R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 unclassified probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
R7348:Ttc37 UTSW 13 76182884 missense possibly damaging 0.82
R7404:Ttc37 UTSW 13 76148747 nonsense probably null
R7421:Ttc37 UTSW 13 76148825 missense probably benign 0.12
R7546:Ttc37 UTSW 13 76134835 missense probably damaging 1.00
R7771:Ttc37 UTSW 13 76135030 missense probably benign 0.21
R8125:Ttc37 UTSW 13 76130327 critical splice donor site probably null
R8136:Ttc37 UTSW 13 76113103 missense probably benign 0.00
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTCTAGGGTTGGCAATGC -3'
(R):5'- CTCAAAAGTCCATGCTACTTCTGTG -3'

Sequencing Primer
(F):5'- AATGCGCGATGCCACACTG -3'
(R):5'- GAGTCAAGGTCTCTCTGAATAGCC -3'
Posted On2019-09-13