Incidental Mutation 'R7384:Polq'
ID 572992
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 045466-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.509) question?
Stock # R7384 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36832148-36915779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36849780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 345 (S345P)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect probably damaging
Transcript: ENSMUST00000054034
AA Change: S345P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: S345P

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,507,191 (GRCm39) I65F possibly damaging Het
Abca13 C A 11: 9,283,257 (GRCm39) S3226R probably damaging Het
Abhd14b A G 9: 106,327,340 (GRCm39) I41V probably benign Het
Acot2 T C 12: 84,039,441 (GRCm39) S317P probably benign Het
Acp7 T C 7: 28,314,513 (GRCm39) E284G possibly damaging Het
Adamts5 A G 16: 85,696,714 (GRCm39) F148L probably benign Het
Adcy10 C T 1: 165,404,177 (GRCm39) P1611S unknown Het
Agr2 A G 12: 36,045,923 (GRCm39) T57A probably damaging Het
Ankar T G 1: 72,697,624 (GRCm39) I1060L probably benign Het
Ano10 T A 9: 122,005,409 (GRCm39) D77V unknown Het
Anxa2r1 T A 13: 120,496,797 (GRCm39) Q24L possibly damaging Het
Apc2 G A 10: 80,148,458 (GRCm39) V1171I probably damaging Het
Apoa4 G A 9: 46,152,772 (GRCm39) R19Q not run Het
Arhgap33 A G 7: 30,226,696 (GRCm39) S504P probably damaging Het
Atg2a T C 19: 6,311,707 (GRCm39) V1862A probably damaging Het
Atp7b T C 8: 22,512,331 (GRCm39) S511G probably benign Het
Bcl10 A G 3: 145,638,795 (GRCm39) K146E possibly damaging Het
Bsg A T 10: 79,545,631 (GRCm39) D181V probably damaging Het
Btg4 T C 9: 51,030,413 (GRCm39) V171A probably benign Het
Cdh8 A C 8: 99,957,138 (GRCm39) N188K probably benign Het
Cflar C A 1: 58,791,735 (GRCm39) T346K Het
Chrna5 T C 9: 54,912,117 (GRCm39) S306P probably damaging Het
Cldn20 G A 17: 3,582,886 (GRCm39) G20R probably damaging Het
Clns1a G A 7: 97,345,988 (GRCm39) A18T probably benign Het
D130043K22Rik A G 13: 25,066,588 (GRCm39) Y795C probably damaging Het
Dync1li2 A C 8: 105,169,175 (GRCm39) S38A probably benign Het
Dysf A G 6: 84,091,087 (GRCm39) E1043G probably benign Het
Elapor1 A T 3: 108,370,784 (GRCm39) probably null Het
Eral1 A G 11: 77,964,927 (GRCm39) I422T possibly damaging Het
Exoc3 G A 13: 74,320,275 (GRCm39) P729S probably benign Het
Eya1 T A 1: 14,299,736 (GRCm39) Y339F probably damaging Het
Faah G T 4: 115,862,364 (GRCm39) N206K probably damaging Het
Fem1a A G 17: 56,564,537 (GRCm39) E210G probably benign Het
Gcc2 T A 10: 58,105,786 (GRCm39) S341T probably damaging Het
Gfpt2 A T 11: 49,701,817 (GRCm39) I123F possibly damaging Het
Gm3047 T A 14: 4,558,271 (GRCm38) N164K probably damaging Het
Gm3327 A G 14: 44,362,334 (GRCm39) K78E Het
Herpud1 A G 8: 95,116,005 (GRCm39) I57V probably damaging Het
Homer1 A T 13: 93,529,547 (GRCm39) R285S possibly damaging Het
Hps6 T A 19: 45,992,456 (GRCm39) V131E possibly damaging Het
Il1r1 T A 1: 40,321,421 (GRCm39) I11N possibly damaging Het
Jakmip1 T A 5: 37,330,551 (GRCm39) D410E possibly damaging Het
Kif3a T A 11: 53,469,681 (GRCm39) F97L probably damaging Het
Klf11 C T 12: 24,703,742 (GRCm39) T76I probably damaging Het
Ldlr A C 9: 21,651,090 (GRCm39) T503P probably benign Het
Mapk3 G C 7: 126,363,463 (GRCm39) R279P Het
Mb21d2 A T 16: 28,647,664 (GRCm39) D103E probably benign Het
Msh4 T A 3: 153,594,385 (GRCm39) M333L probably benign Het
Mycbp2 A G 14: 103,513,829 (GRCm39) I836T probably damaging Het
Myh1 A T 11: 67,115,201 (GRCm39) E1912V possibly damaging Het
Ncapd2 A G 6: 125,150,364 (GRCm39) V887A probably benign Het
Nlrp4a G A 7: 26,148,963 (GRCm39) R190Q not run Het
Nop53 T C 7: 15,673,420 (GRCm39) T344A probably damaging Het
Or2r3 A T 6: 42,448,257 (GRCm39) L285Q possibly damaging Het
Or5an11 T C 19: 12,246,440 (GRCm39) V282A possibly damaging Het
Or7h8 A G 9: 20,124,041 (GRCm39) Y132C probably damaging Het
Pcyox1l A C 18: 61,831,461 (GRCm39) V266G probably damaging Het
Pde5a A G 3: 122,618,649 (GRCm39) Y654C probably damaging Het
Polr1f G T 12: 33,483,631 (GRCm39) G128W probably damaging Het
Prdm1 A T 10: 44,334,503 (GRCm39) C8S probably benign Het
Psg17 T A 7: 18,552,585 (GRCm39) Q230L possibly damaging Het
Rab11fip5 A T 6: 85,325,312 (GRCm39) S332T possibly damaging Het
Rac2 T A 15: 78,446,131 (GRCm39) K186* probably null Het
S100pbp T C 4: 129,075,702 (GRCm39) N208D probably benign Het
Scaf11 A T 15: 96,318,268 (GRCm39) V432D possibly damaging Het
Skic3 A C 13: 76,298,854 (GRCm39) S1187R possibly damaging Het
Slc34a1 G T 13: 55,550,747 (GRCm39) C225F probably benign Het
Slc35e2 A T 4: 155,695,089 (GRCm39) M152L probably benign Het
Slc49a3 A T 5: 108,593,926 (GRCm39) I61K probably damaging Het
Slc9a4 T A 1: 40,651,411 (GRCm39) I563K probably benign Het
Sppl3 T G 5: 115,199,700 (GRCm39) probably null Het
Stam T C 2: 14,139,241 (GRCm39) F301L probably benign Het
Supt16 G A 14: 52,418,619 (GRCm39) R213W probably damaging Het
Tbc1d8 A T 1: 39,433,179 (GRCm39) D334E probably benign Het
Tmem87a C T 2: 120,202,004 (GRCm39) probably null Het
Tnk1 T C 11: 69,742,447 (GRCm39) Y661C probably damaging Het
Tnpo2 G A 8: 85,776,748 (GRCm39) R485H probably damaging Het
Tnxb A G 17: 34,937,492 (GRCm39) D2947G probably damaging Het
Traf4 A G 11: 78,051,617 (GRCm39) probably null Het
Trappc10 A T 10: 78,045,218 (GRCm39) M490K possibly damaging Het
Trav12-1 A G 14: 53,775,993 (GRCm39) T49A probably benign Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,279,032 (GRCm39) probably benign Het
Unc79 G T 12: 103,137,837 (GRCm39) V2485L probably benign Het
Ush2a T C 1: 188,132,360 (GRCm39) S861P probably damaging Het
Vcam1 A G 3: 115,910,877 (GRCm39) V507A possibly damaging Het
Vmn1r218 A G 13: 23,320,895 (GRCm39) M81V probably benign Het
Zfp652 G T 11: 95,643,830 (GRCm39) V343L probably damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 36,885,609 (GRCm39) splice site probably benign
IGL00539:Polq APN 16 36,880,931 (GRCm39) missense probably damaging 0.98
IGL00960:Polq APN 16 36,880,874 (GRCm39) missense probably damaging 0.96
IGL01100:Polq APN 16 36,881,474 (GRCm39) missense probably benign
IGL01112:Polq APN 16 36,837,671 (GRCm39) missense probably damaging 1.00
IGL01138:Polq APN 16 36,866,231 (GRCm39) missense possibly damaging 0.94
IGL01432:Polq APN 16 36,892,184 (GRCm39) splice site probably benign
IGL01522:Polq APN 16 36,848,265 (GRCm39) missense probably damaging 1.00
IGL01565:Polq APN 16 36,833,475 (GRCm39) missense probably benign 0.00
IGL01592:Polq APN 16 36,855,212 (GRCm39) missense probably benign 0.01
IGL01690:Polq APN 16 36,883,200 (GRCm39) missense probably damaging 0.97
IGL01943:Polq APN 16 36,881,805 (GRCm39) missense possibly damaging 0.47
IGL02531:Polq APN 16 36,882,736 (GRCm39) missense possibly damaging 0.75
IGL02553:Polq APN 16 36,862,130 (GRCm39) missense probably damaging 1.00
IGL02623:Polq APN 16 36,880,737 (GRCm39) missense probably benign 0.04
IGL02692:Polq APN 16 36,880,989 (GRCm39) missense probably damaging 1.00
IGL02717:Polq APN 16 36,843,102 (GRCm39) missense probably damaging 1.00
IGL02937:Polq APN 16 36,833,471 (GRCm39) missense probably benign 0.14
IGL02959:Polq APN 16 36,906,928 (GRCm39) missense probably damaging 1.00
IGL03086:Polq APN 16 36,911,411 (GRCm39) missense probably benign 0.02
IGL03141:Polq APN 16 36,837,720 (GRCm39) splice site probably benign
IGL03302:Polq APN 16 36,892,134 (GRCm39) missense probably damaging 1.00
IGL03393:Polq APN 16 36,865,156 (GRCm39) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280_polq_867 UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 36,880,949 (GRCm39) missense probably benign 0.00
R0013:Polq UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R0082:Polq UTSW 16 36,837,619 (GRCm39) missense probably benign 0.01
R0212:Polq UTSW 16 36,887,216 (GRCm39) missense probably damaging 0.99
R0387:Polq UTSW 16 36,909,679 (GRCm39) missense probably damaging 1.00
R0387:Polq UTSW 16 36,849,792 (GRCm39) missense probably damaging 1.00
R0427:Polq UTSW 16 36,882,355 (GRCm39) nonsense probably null
R0454:Polq UTSW 16 36,855,252 (GRCm39) missense probably damaging 0.98
R0513:Polq UTSW 16 36,914,864 (GRCm39) missense probably damaging 1.00
R0622:Polq UTSW 16 36,881,355 (GRCm39) missense probably benign 0.02
R0848:Polq UTSW 16 36,882,492 (GRCm39) missense probably benign 0.08
R1142:Polq UTSW 16 36,833,579 (GRCm39) missense probably damaging 0.98
R1218:Polq UTSW 16 36,849,808 (GRCm39) missense possibly damaging 0.93
R1331:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R1398:Polq UTSW 16 36,882,857 (GRCm39) missense possibly damaging 0.87
R1424:Polq UTSW 16 36,906,890 (GRCm39) missense probably damaging 1.00
R1644:Polq UTSW 16 36,880,626 (GRCm39) missense probably damaging 0.96
R1777:Polq UTSW 16 36,880,586 (GRCm39) missense possibly damaging 0.94
R1820:Polq UTSW 16 36,849,780 (GRCm39) missense possibly damaging 0.48
R1854:Polq UTSW 16 36,882,471 (GRCm39) missense probably benign 0.01
R1880:Polq UTSW 16 36,906,954 (GRCm39) missense possibly damaging 0.90
R1932:Polq UTSW 16 36,882,666 (GRCm39) missense possibly damaging 0.92
R2008:Polq UTSW 16 36,882,844 (GRCm39) missense probably damaging 0.96
R2014:Polq UTSW 16 36,898,728 (GRCm39) missense probably damaging 1.00
R2026:Polq UTSW 16 36,883,107 (GRCm39) missense possibly damaging 0.93
R2178:Polq UTSW 16 36,883,191 (GRCm39) missense probably damaging 1.00
R2259:Polq UTSW 16 36,882,459 (GRCm39) missense probably benign 0.03
R2266:Polq UTSW 16 36,882,515 (GRCm39) missense possibly damaging 0.59
R2305:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R2370:Polq UTSW 16 36,894,301 (GRCm39) missense probably damaging 1.00
R2504:Polq UTSW 16 36,832,304 (GRCm39) missense unknown
R2517:Polq UTSW 16 36,909,687 (GRCm39) missense probably damaging 1.00
R2697:Polq UTSW 16 36,862,515 (GRCm39) missense probably damaging 1.00
R2858:Polq UTSW 16 36,883,115 (GRCm39) missense possibly damaging 0.88
R3436:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3437:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3699:Polq UTSW 16 36,862,518 (GRCm39) missense probably damaging 1.00
R3838:Polq UTSW 16 36,898,711 (GRCm39) missense probably damaging 1.00
R3875:Polq UTSW 16 36,894,389 (GRCm39) missense probably damaging 0.99
R4050:Polq UTSW 16 36,913,182 (GRCm39) critical splice acceptor site probably null
R4172:Polq UTSW 16 36,881,120 (GRCm39) missense probably benign 0.02
R4238:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4240:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280:Polq UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
R4296:Polq UTSW 16 36,881,663 (GRCm39) missense possibly damaging 0.94
R4360:Polq UTSW 16 36,880,701 (GRCm39) missense probably benign 0.00
R4373:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4375:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4376:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4509:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4510:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4511:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4543:Polq UTSW 16 36,881,147 (GRCm39) missense probably benign 0.43
R4633:Polq UTSW 16 36,868,904 (GRCm39) missense probably damaging 1.00
R4739:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R4834:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 1.00
R4841:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4842:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4937:Polq UTSW 16 36,848,274 (GRCm39) missense probably benign 0.01
R4955:Polq UTSW 16 36,881,444 (GRCm39) missense probably benign 0.32
R4992:Polq UTSW 16 36,881,524 (GRCm39) missense possibly damaging 0.59
R5008:Polq UTSW 16 36,882,749 (GRCm39) missense probably benign
R5221:Polq UTSW 16 36,862,540 (GRCm39) missense probably damaging 0.98
R5254:Polq UTSW 16 36,909,681 (GRCm39) missense probably damaging 1.00
R5292:Polq UTSW 16 36,881,745 (GRCm39) missense probably damaging 1.00
R5375:Polq UTSW 16 36,903,146 (GRCm39) missense probably damaging 1.00
R5480:Polq UTSW 16 36,833,652 (GRCm39) splice site probably benign
R5552:Polq UTSW 16 36,914,872 (GRCm39) missense possibly damaging 0.93
R5591:Polq UTSW 16 36,832,247 (GRCm39) utr 5 prime probably benign
R5653:Polq UTSW 16 36,860,896 (GRCm39) missense probably damaging 1.00
R5708:Polq UTSW 16 36,881,380 (GRCm39) missense probably damaging 0.98
R5754:Polq UTSW 16 36,837,625 (GRCm39) missense probably benign
R5757:Polq UTSW 16 36,907,043 (GRCm39) missense probably benign 0.01
R5764:Polq UTSW 16 36,837,706 (GRCm39) missense probably damaging 0.97
R6019:Polq UTSW 16 36,882,126 (GRCm39) missense probably damaging 1.00
R6170:Polq UTSW 16 36,866,174 (GRCm39) missense possibly damaging 0.82
R6177:Polq UTSW 16 36,892,071 (GRCm39) missense probably damaging 0.98
R6307:Polq UTSW 16 36,837,718 (GRCm39) critical splice donor site probably null
R6499:Polq UTSW 16 36,881,189 (GRCm39) missense probably benign 0.03
R6520:Polq UTSW 16 36,880,739 (GRCm39) missense possibly damaging 0.88
R6598:Polq UTSW 16 36,881,993 (GRCm39) missense probably benign 0.39
R6694:Polq UTSW 16 36,835,535 (GRCm39) missense probably null 0.99
R6788:Polq UTSW 16 36,897,510 (GRCm39) missense probably damaging 1.00
R7104:Polq UTSW 16 36,909,715 (GRCm39) nonsense probably null
R7159:Polq UTSW 16 36,883,215 (GRCm39) missense possibly damaging 0.87
R7222:Polq UTSW 16 36,906,995 (GRCm39) nonsense probably null
R7340:Polq UTSW 16 36,881,288 (GRCm39) missense probably benign 0.00
R7361:Polq UTSW 16 36,880,790 (GRCm39) missense probably benign 0.00
R7509:Polq UTSW 16 36,880,705 (GRCm39) missense probably benign
R7509:Polq UTSW 16 36,880,706 (GRCm39) missense probably benign 0.00
R7575:Polq UTSW 16 36,911,496 (GRCm39) missense probably benign 0.00
R7785:Polq UTSW 16 36,848,239 (GRCm39) missense probably damaging 1.00
R7787:Polq UTSW 16 36,837,671 (GRCm39) missense probably damaging 1.00
R7891:Polq UTSW 16 36,848,244 (GRCm39) missense probably damaging 1.00
R7898:Polq UTSW 16 36,865,245 (GRCm39) missense probably damaging 0.98
R7917:Polq UTSW 16 36,885,650 (GRCm39) missense probably benign 0.08
R7940:Polq UTSW 16 36,881,004 (GRCm39) missense probably benign 0.27
R8028:Polq UTSW 16 36,881,678 (GRCm39) missense possibly damaging 0.82
R8114:Polq UTSW 16 36,862,577 (GRCm39) missense possibly damaging 0.94
R8144:Polq UTSW 16 36,849,846 (GRCm39) missense probably benign 0.01
R8288:Polq UTSW 16 36,848,272 (GRCm39) missense probably damaging 1.00
R8301:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
R8341:Polq UTSW 16 36,892,133 (GRCm39) missense possibly damaging 0.96
R8348:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8448:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8815:Polq UTSW 16 36,853,893 (GRCm39) missense probably damaging 1.00
R8843:Polq UTSW 16 36,832,280 (GRCm39) missense unknown
R8878:Polq UTSW 16 36,860,869 (GRCm39) missense probably benign 0.02
R9016:Polq UTSW 16 36,843,159 (GRCm39) missense probably damaging 1.00
R9189:Polq UTSW 16 36,865,265 (GRCm39) missense probably damaging 1.00
R9209:Polq UTSW 16 36,869,011 (GRCm39) missense possibly damaging 0.94
R9352:Polq UTSW 16 36,862,252 (GRCm39) missense probably damaging 0.98
R9398:Polq UTSW 16 36,881,394 (GRCm39) missense probably benign 0.02
R9403:Polq UTSW 16 36,882,215 (GRCm39) missense probably benign 0.00
R9489:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9605:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9664:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 0.98
R9801:Polq UTSW 16 36,913,190 (GRCm39) missense probably damaging 1.00
X0060:Polq UTSW 16 36,837,599 (GRCm39) nonsense probably null
Z1176:Polq UTSW 16 36,862,619 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCAGCACCTGAGTTAATAAC -3'
(R):5'- CAGTGACAGTACCAGAGCAG -3'

Sequencing Primer
(F):5'- GCACCTGAGTTAATAACCACAAGTTG -3'
(R):5'- CAGAGATGTGCTTTGCTACAAAC -3'
Posted On 2019-09-13