Incidental Mutation 'R7385:Ahctf1'
ID573003
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7385 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 179753381 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1752 (E1752G)
Ref Sequence ENSEMBL: ENSMUSP00000027768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000125816]
PDB Structure
Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027768
AA Change: E1752G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: E1752G

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000125816
Predicted Effect probably benign
Transcript: ENSMUST00000140489
SMART Domains Protein: ENSMUSP00000115253
Gene: ENSMUSG00000026491

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Derl2 A G 11: 71,018,938 probably benign Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 AG A 19: 5,608,269 probably null Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Myt1 A G 2: 181,767,705 probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R6998:Ahctf1 UTSW 1 179770915 nonsense probably null
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179790314 missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179762846 missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179770848 missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179768315 missense probably benign
R7846:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7912:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
R7929:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7993:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Z1177:Ahctf1 UTSW 1 179793730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTCTTCAGCTGCTGGC -3'
(R):5'- GTCTCAAAGGCTGCACATTC -3'

Sequencing Primer
(F):5'- CCAGAACTTGGCAGTGTGC -3'
(R):5'- AAGGCTGCACATTCGTCCAG -3'
Posted On2019-09-13