Mutagenetix > Incidental Mutation

Incidental Mutation 'R7385:Ticrr'

573026

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R7385 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 79691849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1061 (S1061N)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: S1061N

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S1061N

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206591

Predicted Effect

probably benign
Transcript: ENSMUST00000206622

Meta Mutation Damage Score

0.0663

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,287,737	E3146D	probably benign	Het
4932415D10Rik	T	C	10: 82,287,895	S3094G	probably benign	Het
Ahctf1	T	C	1: 179,753,381	E1752G	possibly damaging	Het
Aqp3	T	C	4: 41,095,178	T68A	probably damaging	Het
Arhgap40	A	G	2: 158,543,227	K463R	probably damaging	Het
Asb10	A	T	5: 24,533,738	C440*	probably null	Het
Bach1	A	G	16: 87,729,497	T616A	probably damaging	Het
Braf	T	A	6: 39,665,108		probably null	Het
Cacna1s	A	T	1: 136,092,633	N803Y	probably damaging	Het
Cald1	A	G	6: 34,686,065	E21G	probably damaging	Het
Caskin1	G	T	17: 24,503,924	G589C	probably damaging	Het
Cdc37l1	T	C	19: 28,990,671		probably null	Het
Cntnap5b	G	A	1: 100,379,090	G844D	probably damaging	Het
Col5a1	T	C	2: 28,024,750	L1615P	unknown	Het
Cpt1a	C	A	19: 3,380,155	P672T	probably damaging	Het
Defb22	A	G	2: 152,486,197	Y23H	probably damaging	Het
Depdc1b	G	C	13: 108,363,632	K226N	probably damaging	Het
Derl2	A	G	11: 71,018,938		probably benign	Het
Dnaja2	T	C	8: 85,539,353	T368A	probably benign	Het
Dsg3	C	A	18: 20,540,197	T975K	possibly damaging	Het
Eif4enif1	T	A	11: 3,220,269	D107E	probably damaging	Het
Fut11	A	G	14: 20,696,257	D389G	probably damaging	Het
Gopc	C	T	10: 52,349,232	G299E	probably damaging	Het
Gprin1	T	C	13: 54,738,610	D617G	probably benign	Het
Grin2d	A	G	7: 45,857,536	V505A	probably damaging	Het
Heatr6	T	C	11: 83,759,335	Y206H	probably damaging	Het
Hhex	C	A	19: 37,437,265	N147K	probably damaging	Het
Igkv4-80	G	A	6: 69,016,715	S64F	probably damaging	Het
Jakmip3	A	G	7: 139,023,339	K360R	possibly damaging	Het
Kat5	AG	A	19: 5,608,269		probably null	Het
Kat5	T	A	19: 5,608,274	N191I	probably benign	Het
Kifc5b	A	G	17: 26,925,623	D572G	probably damaging	Het
Lrp5	C	A	19: 3,612,197		probably null	Het
Lrtm1	A	G	14: 29,027,716	M345V	probably benign	Het
Mbd5	T	C	2: 49,272,449	V981A	probably benign	Het
Mier3	G	A	13: 111,705,249	G115S	possibly damaging	Het
Mrgprd	A	G	7: 145,321,524	N44S	probably damaging	Het
Mrps10	C	A	17: 47,378,221	P181Q	probably damaging	Het
Myot	T	A	18: 44,337,008	C17*	probably null	Het
Myt1	A	G	2: 181,767,705		probably null	Het
Ncoa6	C	A	2: 155,407,801	L1194F	probably damaging	Het
Olfr1355	C	A	10: 78,879,454	T94K	probably damaging	Het
Olfr1423	T	C	19: 12,035,999	T248A	probably benign	Het
Olfr1428	T	C	19: 12,108,697	N57S	probably damaging	Het
Olfr1507	T	C	14: 52,490,181	Y261C	probably damaging	Het
Olfr58	T	A	9: 19,783,211	I26N	possibly damaging	Het
Osbpl6	G	A	2: 76,549,450	G128E	probably damaging	Het
P3h3	A	T	6: 124,855,270	Y218N	probably damaging	Het
Paxip1	A	G	5: 27,781,420		probably null	Het
Pdia5	T	C	16: 35,429,914	Y225C	probably damaging	Het
Pik3c2g	T	G	6: 139,855,353	M526R		Het
Prox1	A	G	1: 190,162,126	F41L	probably benign	Het
Psd3	A	T	8: 68,000,756	F284I	probably damaging	Het
Rev3l	T	A	10: 39,823,682	C1392S	probably benign	Het
Rfxank	A	T	8: 70,134,635	V212E	probably damaging	Het
Ros1	T	C	10: 52,155,126	D482G	probably benign	Het
Sat2	A	T	11: 69,622,937	I94F	probably damaging	Het
Scarf2	T	C	16: 17,803,838	L384P	probably damaging	Het
Sec14l2	C	A	11: 4,116,750	E21*	probably null	Het
Slitrk5	T	A	14: 111,680,699	V585E	probably benign	Het
Tas2r130	T	A	6: 131,630,263	M190L	probably benign	Het
Tlr9	C	A	9: 106,225,264	H585N	probably damaging	Het
Tmem219	A	T	7: 126,896,775	I142N	probably damaging	Het
Tnni2	A	G	7: 142,443,178	N8S	probably benign	Het
Tnpo2	G	A	8: 85,050,119	R485H	probably damaging	Het
Ttc8	A	G	12: 98,942,288	E72G	possibly damaging	Het
Upf1	A	G	8: 70,340,618	Y297H	probably damaging	Het
Vmn1r4	A	G	6: 56,956,736	K75R	probably damaging	Het
Vmn2r78	G	A	7: 86,922,425	G481D	probably benign	Het
Vmn2r96	A	G	17: 18,583,040	Y404C	probably damaging	Het
Vps50	T	A	6: 3,602,708	S942T	probably benign	Het
Xkr7	C	A	2: 153,054,063	S279*	probably null	Het
Zan	G	A	5: 137,434,154	Q2294*	probably null	Het
Zan	T	C	5: 137,450,491	Y1700C	unknown	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- AAATCAGTTACTTCAGTTGCTCCC -3'
(R):5'- ATGTTCCCCAAGACTGCACC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- TTCCCCAAGACTGCACCATTTTAAAC -3'

Posted On

2019-09-13