Incidental Mutation 'R7385:Ticrr'
ID 573026
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 045467-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R7385 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79341597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1061 (S1061N)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: S1061N

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S1061N

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 T C 1: 179,580,946 (GRCm39) E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 (GRCm39) T68A probably damaging Het
Arhgap40 A G 2: 158,385,147 (GRCm39) K463R probably damaging Het
Asb10 A T 5: 24,738,736 (GRCm39) C440* probably null Het
Bach1 A G 16: 87,526,385 (GRCm39) T616A probably damaging Het
Braf T A 6: 39,642,042 (GRCm39) probably null Het
Cacna1s A T 1: 136,020,371 (GRCm39) N803Y probably damaging Het
Cald1 A G 6: 34,663,000 (GRCm39) E21G probably damaging Het
Caskin1 G T 17: 24,722,898 (GRCm39) G589C probably damaging Het
Cdc37l1 T C 19: 28,968,071 (GRCm39) probably null Het
Cntnap5b G A 1: 100,306,815 (GRCm39) G844D probably damaging Het
Col5a1 T C 2: 27,914,762 (GRCm39) L1615P unknown Het
Cpt1a C A 19: 3,430,155 (GRCm39) P672T probably damaging Het
Defb22 A G 2: 152,328,117 (GRCm39) Y23H probably damaging Het
Depdc1b G C 13: 108,500,166 (GRCm39) K226N probably damaging Het
Derl2 A G 11: 70,909,764 (GRCm39) probably benign Het
Dnaja2 T C 8: 86,265,982 (GRCm39) T368A probably benign Het
Dsg3 C A 18: 20,673,254 (GRCm39) T975K possibly damaging Het
Eif4enif1 T A 11: 3,170,269 (GRCm39) D107E probably damaging Het
Fut11 A G 14: 20,746,325 (GRCm39) D389G probably damaging Het
Gopc C T 10: 52,225,328 (GRCm39) G299E probably damaging Het
Gprin1 T C 13: 54,886,423 (GRCm39) D617G probably benign Het
Grin2d A G 7: 45,506,960 (GRCm39) V505A probably damaging Het
Heatr6 T C 11: 83,650,161 (GRCm39) Y206H probably damaging Het
Hhex C A 19: 37,425,713 (GRCm39) N147K probably damaging Het
Igkv4-80 G A 6: 68,993,699 (GRCm39) S64F probably damaging Het
Jakmip3 A G 7: 138,625,068 (GRCm39) K360R possibly damaging Het
Kat5 AG A 19: 5,658,297 (GRCm39) probably null Het
Kat5 T A 19: 5,658,302 (GRCm39) N191I probably benign Het
Kifc5b A G 17: 27,144,597 (GRCm39) D572G probably damaging Het
Lrp5 C A 19: 3,662,197 (GRCm39) probably null Het
Lrtm1 A G 14: 28,749,673 (GRCm39) M345V probably benign Het
Mbd5 T C 2: 49,162,461 (GRCm39) V981A probably benign Het
Mier3 G A 13: 111,841,783 (GRCm39) G115S possibly damaging Het
Mrgprd A G 7: 144,875,261 (GRCm39) N44S probably damaging Het
Mrps10 C A 17: 47,689,146 (GRCm39) P181Q probably damaging Het
Myot T A 18: 44,470,075 (GRCm39) C17* probably null Het
Myt1 A G 2: 181,409,498 (GRCm39) probably null Het
Ncoa6 C A 2: 155,249,721 (GRCm39) L1194F probably damaging Het
Or4d11 T C 19: 12,013,363 (GRCm39) T248A probably benign Het
Or4d6 T C 19: 12,086,061 (GRCm39) N57S probably damaging Het
Or4e5 T C 14: 52,727,638 (GRCm39) Y261C probably damaging Het
Or7a39 C A 10: 78,715,288 (GRCm39) T94K probably damaging Het
Or7e165 T A 9: 19,694,507 (GRCm39) I26N possibly damaging Het
Osbpl6 G A 2: 76,379,794 (GRCm39) G128E probably damaging Het
P3h3 A T 6: 124,832,233 (GRCm39) Y218N probably damaging Het
Paxip1 A G 5: 27,986,418 (GRCm39) probably null Het
Pdia5 T C 16: 35,250,284 (GRCm39) Y225C probably damaging Het
Pik3c2g T G 6: 139,801,079 (GRCm39) M526R Het
Prox1 A G 1: 189,894,323 (GRCm39) F41L probably benign Het
Psd3 A T 8: 68,453,408 (GRCm39) F284I probably damaging Het
Rev3l T A 10: 39,699,678 (GRCm39) C1392S probably benign Het
Rfxank A T 8: 70,587,285 (GRCm39) V212E probably damaging Het
Ros1 T C 10: 52,031,222 (GRCm39) D482G probably benign Het
Sat2 A T 11: 69,513,763 (GRCm39) I94F probably damaging Het
Scarf2 T C 16: 17,621,702 (GRCm39) L384P probably damaging Het
Sec14l2 C A 11: 4,066,750 (GRCm39) E21* probably null Het
Slitrk5 T A 14: 111,918,131 (GRCm39) V585E probably benign Het
Spata31h1 T A 10: 82,123,571 (GRCm39) E3146D probably benign Het
Spata31h1 T C 10: 82,123,729 (GRCm39) S3094G probably benign Het
Tas2r130 T A 6: 131,607,226 (GRCm39) M190L probably benign Het
Tlr9 C A 9: 106,102,463 (GRCm39) H585N probably damaging Het
Tmem219 A T 7: 126,495,947 (GRCm39) I142N probably damaging Het
Tnni2 A G 7: 141,996,915 (GRCm39) N8S probably benign Het
Tnpo2 G A 8: 85,776,748 (GRCm39) R485H probably damaging Het
Ttc8 A G 12: 98,908,547 (GRCm39) E72G possibly damaging Het
Upf1 A G 8: 70,793,268 (GRCm39) Y297H probably damaging Het
Vmn1r4 A G 6: 56,933,721 (GRCm39) K75R probably damaging Het
Vmn2r78 G A 7: 86,571,633 (GRCm39) G481D probably benign Het
Vmn2r96 A G 17: 18,803,302 (GRCm39) Y404C probably damaging Het
Vps50 T A 6: 3,602,708 (GRCm39) S942T probably benign Het
Xkr7 C A 2: 152,895,983 (GRCm39) S279* probably null Het
Zan G A 5: 137,432,416 (GRCm39) Q2294* probably null Het
Zan T C 5: 137,448,753 (GRCm39) Y1700C unknown Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAATCAGTTACTTCAGTTGCTCCC -3'
(R):5'- ATGTTCCCCAAGACTGCACC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- TTCCCCAAGACTGCACCATTTTAAAC -3'
Posted On 2019-09-13