Incidental Mutation 'R7385:Vmn2r78'
ID573027
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7385 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86922425 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 481 (G481D)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect probably benign
Transcript: ENSMUST00000170835
AA Change: G481D

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: G481D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Derl2 A G 11: 71,018,938 probably benign Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 AG A 19: 5,608,269 probably null Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Myt1 A G 2: 181,767,705 probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R7935:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGATAATGGATATGAGTGGCATTCC -3'
(R):5'- ACCGAACGATCTCCCTTTAC -3'

Sequencing Primer
(F):5'- GTGGCATTCCAATCTTTATGATTTC -3'
(R):5'- TCATGAAACATGAGTGAGTGAATG -3'
Posted On2019-09-13