Incidental Mutation 'R7385:Rfxank'
ID573033
Institutional Source Beutler Lab
Gene Symbol Rfxank
Ensembl Gene ENSMUSG00000036120
Gene Nameregulatory factor X-associated ankyrin-containing protein
SynonymsTvl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7385 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70130794-70139154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70134635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 212 (V212E)
Ref Sequence ENSEMBL: ENSMUSP00000148739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002418] [ENSMUST00000075724] [ENSMUST00000095273] [ENSMUST00000211898] [ENSMUST00000212320]
Predicted Effect probably benign
Transcript: ENSMUST00000002418
SMART Domains Protein: ENSMUSP00000002418
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 119 1.7e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075724
AA Change: V202E

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075140
Gene: ENSMUSG00000036120
AA Change: V202E

DomainStartEndE-ValueType
ANK 132 161 1.36e-2 SMART
ANK 165 194 5.16e-3 SMART
ANK 198 227 7.42e-4 SMART
ANK 231 260 2.35e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095273
SMART Domains Protein: ENSMUSP00000092907
Gene: ENSMUSG00000071078

DomainStartEndE-ValueType
SCOP:d1jhja_ 22 64 6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211898
Predicted Effect probably damaging
Transcript: ENSMUST00000212320
AA Change: V212E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Derl2 A G 11: 71,018,938 probably benign Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 AG A 19: 5,608,269 probably null Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Myt1 A G 2: 181,767,705 probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Rfxank
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1576:Rfxank UTSW 8 70134303 missense possibly damaging 0.95
R4303:Rfxank UTSW 8 70136212 missense probably damaging 1.00
R7033:Rfxank UTSW 8 70138170 missense probably benign
R7355:Rfxank UTSW 8 70135307 missense probably damaging 1.00
R7399:Rfxank UTSW 8 70135286 splice site probably null
R8218:Rfxank UTSW 8 70131435 splice site probably null
R8377:Rfxank UTSW 8 70135310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGTTTAGAGTCTCTGAGG -3'
(R):5'- GCTATAAATGGCCGGTTCACAG -3'

Sequencing Primer
(F):5'- TAGAGTCTCTGAGGCATGGAG -3'
(R):5'- CTTCCTGGAAGAATGGGCATC -3'
Posted On2019-09-13