Incidental Mutation 'R7385:Upf1'
ID 573034
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
MMRRC Submission 045467-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R7385 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70793268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 297 (Y297H)
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably damaging
Transcript: ENSMUST00000075666
AA Change: Y297H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: Y297H

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215817
AA Change: Y297H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9535 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 T C 1: 179,580,946 (GRCm39) E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 (GRCm39) T68A probably damaging Het
Arhgap40 A G 2: 158,385,147 (GRCm39) K463R probably damaging Het
Asb10 A T 5: 24,738,736 (GRCm39) C440* probably null Het
Bach1 A G 16: 87,526,385 (GRCm39) T616A probably damaging Het
Braf T A 6: 39,642,042 (GRCm39) probably null Het
Cacna1s A T 1: 136,020,371 (GRCm39) N803Y probably damaging Het
Cald1 A G 6: 34,663,000 (GRCm39) E21G probably damaging Het
Caskin1 G T 17: 24,722,898 (GRCm39) G589C probably damaging Het
Cdc37l1 T C 19: 28,968,071 (GRCm39) probably null Het
Cntnap5b G A 1: 100,306,815 (GRCm39) G844D probably damaging Het
Col5a1 T C 2: 27,914,762 (GRCm39) L1615P unknown Het
Cpt1a C A 19: 3,430,155 (GRCm39) P672T probably damaging Het
Defb22 A G 2: 152,328,117 (GRCm39) Y23H probably damaging Het
Depdc1b G C 13: 108,500,166 (GRCm39) K226N probably damaging Het
Derl2 A G 11: 70,909,764 (GRCm39) probably benign Het
Dnaja2 T C 8: 86,265,982 (GRCm39) T368A probably benign Het
Dsg3 C A 18: 20,673,254 (GRCm39) T975K possibly damaging Het
Eif4enif1 T A 11: 3,170,269 (GRCm39) D107E probably damaging Het
Fut11 A G 14: 20,746,325 (GRCm39) D389G probably damaging Het
Gopc C T 10: 52,225,328 (GRCm39) G299E probably damaging Het
Gprin1 T C 13: 54,886,423 (GRCm39) D617G probably benign Het
Grin2d A G 7: 45,506,960 (GRCm39) V505A probably damaging Het
Heatr6 T C 11: 83,650,161 (GRCm39) Y206H probably damaging Het
Hhex C A 19: 37,425,713 (GRCm39) N147K probably damaging Het
Igkv4-80 G A 6: 68,993,699 (GRCm39) S64F probably damaging Het
Jakmip3 A G 7: 138,625,068 (GRCm39) K360R possibly damaging Het
Kat5 AG A 19: 5,658,297 (GRCm39) probably null Het
Kat5 T A 19: 5,658,302 (GRCm39) N191I probably benign Het
Kifc5b A G 17: 27,144,597 (GRCm39) D572G probably damaging Het
Lrp5 C A 19: 3,662,197 (GRCm39) probably null Het
Lrtm1 A G 14: 28,749,673 (GRCm39) M345V probably benign Het
Mbd5 T C 2: 49,162,461 (GRCm39) V981A probably benign Het
Mier3 G A 13: 111,841,783 (GRCm39) G115S possibly damaging Het
Mrgprd A G 7: 144,875,261 (GRCm39) N44S probably damaging Het
Mrps10 C A 17: 47,689,146 (GRCm39) P181Q probably damaging Het
Myot T A 18: 44,470,075 (GRCm39) C17* probably null Het
Myt1 A G 2: 181,409,498 (GRCm39) probably null Het
Ncoa6 C A 2: 155,249,721 (GRCm39) L1194F probably damaging Het
Or4d11 T C 19: 12,013,363 (GRCm39) T248A probably benign Het
Or4d6 T C 19: 12,086,061 (GRCm39) N57S probably damaging Het
Or4e5 T C 14: 52,727,638 (GRCm39) Y261C probably damaging Het
Or7a39 C A 10: 78,715,288 (GRCm39) T94K probably damaging Het
Or7e165 T A 9: 19,694,507 (GRCm39) I26N possibly damaging Het
Osbpl6 G A 2: 76,379,794 (GRCm39) G128E probably damaging Het
P3h3 A T 6: 124,832,233 (GRCm39) Y218N probably damaging Het
Paxip1 A G 5: 27,986,418 (GRCm39) probably null Het
Pdia5 T C 16: 35,250,284 (GRCm39) Y225C probably damaging Het
Pik3c2g T G 6: 139,801,079 (GRCm39) M526R Het
Prox1 A G 1: 189,894,323 (GRCm39) F41L probably benign Het
Psd3 A T 8: 68,453,408 (GRCm39) F284I probably damaging Het
Rev3l T A 10: 39,699,678 (GRCm39) C1392S probably benign Het
Rfxank A T 8: 70,587,285 (GRCm39) V212E probably damaging Het
Ros1 T C 10: 52,031,222 (GRCm39) D482G probably benign Het
Sat2 A T 11: 69,513,763 (GRCm39) I94F probably damaging Het
Scarf2 T C 16: 17,621,702 (GRCm39) L384P probably damaging Het
Sec14l2 C A 11: 4,066,750 (GRCm39) E21* probably null Het
Slitrk5 T A 14: 111,918,131 (GRCm39) V585E probably benign Het
Spata31h1 T A 10: 82,123,571 (GRCm39) E3146D probably benign Het
Spata31h1 T C 10: 82,123,729 (GRCm39) S3094G probably benign Het
Tas2r130 T A 6: 131,607,226 (GRCm39) M190L probably benign Het
Ticrr G A 7: 79,341,597 (GRCm39) S1061N possibly damaging Het
Tlr9 C A 9: 106,102,463 (GRCm39) H585N probably damaging Het
Tmem219 A T 7: 126,495,947 (GRCm39) I142N probably damaging Het
Tnni2 A G 7: 141,996,915 (GRCm39) N8S probably benign Het
Tnpo2 G A 8: 85,776,748 (GRCm39) R485H probably damaging Het
Ttc8 A G 12: 98,908,547 (GRCm39) E72G possibly damaging Het
Vmn1r4 A G 6: 56,933,721 (GRCm39) K75R probably damaging Het
Vmn2r78 G A 7: 86,571,633 (GRCm39) G481D probably benign Het
Vmn2r96 A G 17: 18,803,302 (GRCm39) Y404C probably damaging Het
Vps50 T A 6: 3,602,708 (GRCm39) S942T probably benign Het
Xkr7 C A 2: 152,895,983 (GRCm39) S279* probably null Het
Zan G A 5: 137,432,416 (GRCm39) Q2294* probably null Het
Zan T C 5: 137,448,753 (GRCm39) Y1700C unknown Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2143:Upf1 UTSW 8 70,792,004 (GRCm39) missense probably null 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4838:Upf1 UTSW 8 70,792,018 (GRCm39) missense probably benign 0.03
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7205:Upf1 UTSW 8 70,792,695 (GRCm39) missense possibly damaging 0.94
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8079:Upf1 UTSW 8 70,791,534 (GRCm39) critical splice donor site probably null
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8544:Upf1 UTSW 8 70,789,702 (GRCm39) missense probably damaging 1.00
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70,786,815 (GRCm39) nonsense probably null
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTTGGAGCTGCAGACAAAGC -3'
(R):5'- TCTCCACCTACGAGGGTTTG -3'

Sequencing Primer
(F):5'- GTGAACCAGACACAAGGGTTTTCTC -3'
(R):5'- CACCTACGAGGGTTTGTGCTG -3'
Posted On 2019-09-13