Mutagenetix > Incidental Mutation

Incidental Mutation 'R7385:Upf1'

573034

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R7385 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70340618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 297 (Y297H)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: Y297H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: Y297H

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: Y297H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9535

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,287,737	E3146D	probably benign	Het
4932415D10Rik	T	C	10: 82,287,895	S3094G	probably benign	Het
Ahctf1	T	C	1: 179,753,381	E1752G	possibly damaging	Het
Aqp3	T	C	4: 41,095,178	T68A	probably damaging	Het
Arhgap40	A	G	2: 158,543,227	K463R	probably damaging	Het
Asb10	A	T	5: 24,533,738	C440*	probably null	Het
Bach1	A	G	16: 87,729,497	T616A	probably damaging	Het
Braf	T	A	6: 39,665,108		probably null	Het
Cacna1s	A	T	1: 136,092,633	N803Y	probably damaging	Het
Cald1	A	G	6: 34,686,065	E21G	probably damaging	Het
Caskin1	G	T	17: 24,503,924	G589C	probably damaging	Het
Cdc37l1	T	C	19: 28,990,671		probably null	Het
Cntnap5b	G	A	1: 100,379,090	G844D	probably damaging	Het
Col5a1	T	C	2: 28,024,750	L1615P	unknown	Het
Cpt1a	C	A	19: 3,380,155	P672T	probably damaging	Het
Defb22	A	G	2: 152,486,197	Y23H	probably damaging	Het
Depdc1b	G	C	13: 108,363,632	K226N	probably damaging	Het
Derl2	A	G	11: 71,018,938		probably benign	Het
Dnaja2	T	C	8: 85,539,353	T368A	probably benign	Het
Dsg3	C	A	18: 20,540,197	T975K	possibly damaging	Het
Eif4enif1	T	A	11: 3,220,269	D107E	probably damaging	Het
Fut11	A	G	14: 20,696,257	D389G	probably damaging	Het
Gopc	C	T	10: 52,349,232	G299E	probably damaging	Het
Gprin1	T	C	13: 54,738,610	D617G	probably benign	Het
Grin2d	A	G	7: 45,857,536	V505A	probably damaging	Het
Heatr6	T	C	11: 83,759,335	Y206H	probably damaging	Het
Hhex	C	A	19: 37,437,265	N147K	probably damaging	Het
Igkv4-80	G	A	6: 69,016,715	S64F	probably damaging	Het
Jakmip3	A	G	7: 139,023,339	K360R	possibly damaging	Het
Kat5	AG	A	19: 5,608,269		probably null	Het
Kat5	T	A	19: 5,608,274	N191I	probably benign	Het
Kifc5b	A	G	17: 26,925,623	D572G	probably damaging	Het
Lrp5	C	A	19: 3,612,197		probably null	Het
Lrtm1	A	G	14: 29,027,716	M345V	probably benign	Het
Mbd5	T	C	2: 49,272,449	V981A	probably benign	Het
Mier3	G	A	13: 111,705,249	G115S	possibly damaging	Het
Mrgprd	A	G	7: 145,321,524	N44S	probably damaging	Het
Mrps10	C	A	17: 47,378,221	P181Q	probably damaging	Het
Myot	T	A	18: 44,337,008	C17*	probably null	Het
Myt1	A	G	2: 181,767,705		probably null	Het
Ncoa6	C	A	2: 155,407,801	L1194F	probably damaging	Het
Olfr1355	C	A	10: 78,879,454	T94K	probably damaging	Het
Olfr1423	T	C	19: 12,035,999	T248A	probably benign	Het
Olfr1428	T	C	19: 12,108,697	N57S	probably damaging	Het
Olfr1507	T	C	14: 52,490,181	Y261C	probably damaging	Het
Olfr58	T	A	9: 19,783,211	I26N	possibly damaging	Het
Osbpl6	G	A	2: 76,549,450	G128E	probably damaging	Het
P3h3	A	T	6: 124,855,270	Y218N	probably damaging	Het
Paxip1	A	G	5: 27,781,420		probably null	Het
Pdia5	T	C	16: 35,429,914	Y225C	probably damaging	Het
Pik3c2g	T	G	6: 139,855,353	M526R		Het
Prox1	A	G	1: 190,162,126	F41L	probably benign	Het
Psd3	A	T	8: 68,000,756	F284I	probably damaging	Het
Rev3l	T	A	10: 39,823,682	C1392S	probably benign	Het
Rfxank	A	T	8: 70,134,635	V212E	probably damaging	Het
Ros1	T	C	10: 52,155,126	D482G	probably benign	Het
Sat2	A	T	11: 69,622,937	I94F	probably damaging	Het
Scarf2	T	C	16: 17,803,838	L384P	probably damaging	Het
Sec14l2	C	A	11: 4,116,750	E21*	probably null	Het
Slitrk5	T	A	14: 111,680,699	V585E	probably benign	Het
Tas2r130	T	A	6: 131,630,263	M190L	probably benign	Het
Ticrr	G	A	7: 79,691,849	S1061N	possibly damaging	Het
Tlr9	C	A	9: 106,225,264	H585N	probably damaging	Het
Tmem219	A	T	7: 126,896,775	I142N	probably damaging	Het
Tnni2	A	G	7: 142,443,178	N8S	probably benign	Het
Tnpo2	G	A	8: 85,050,119	R485H	probably damaging	Het
Ttc8	A	G	12: 98,942,288	E72G	possibly damaging	Het
Vmn1r4	A	G	6: 56,956,736	K75R	probably damaging	Het
Vmn2r78	G	A	7: 86,922,425	G481D	probably benign	Het
Vmn2r96	A	G	17: 18,583,040	Y404C	probably damaging	Het
Vps50	T	A	6: 3,602,708	S942T	probably benign	Het
Xkr7	C	A	2: 153,054,063	S279*	probably null	Het
Zan	G	A	5: 137,434,154	Q2294*	probably null	Het
Zan	T	C	5: 137,450,491	Y1700C	unknown	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCTTGGAGCTGCAGACAAAGC -3'
(R):5'- TCTCCACCTACGAGGGTTTG -3'

Sequencing Primer
(F):5'- GTGAACCAGACACAAGGGTTTTCTC -3'
(R):5'- CACCTACGAGGGTTTGTGCTG -3'

Posted On

2019-09-13