Incidental Mutation 'R7385:Fut11'
ID573053
Institutional Source Beutler Lab
Gene Symbol Fut11
Ensembl Gene ENSMUSG00000039357
Gene Namefucosyltransferase 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7385 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20694968-20701016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20696257 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 389 (D389G)
Ref Sequence ENSEMBL: ENSMUSP00000040370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048016] [ENSMUST00000048657] [ENSMUST00000223751] [ENSMUST00000224791]
Predicted Effect probably damaging
Transcript: ENSMUST00000048016
AA Change: D389G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040370
Gene: ENSMUSG00000039357
AA Change: D389G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_tran_10_N 70 178 2.6e-12 PFAM
Pfam:Glyco_transf_10 204 403 2.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048657
SMART Domains Protein: ENSMUSP00000045955
Gene: ENSMUSG00000039367

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 8.2e-17 PFAM
Pfam:Sec23_trunk 501 745 7.3e-94 PFAM
Pfam:Sec23_BS 750 834 8e-20 PFAM
Pfam:Sec23_helical 847 948 2.3e-30 PFAM
Pfam:Gelsolin 963 1038 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223751
Predicted Effect probably benign
Transcript: ENSMUST00000224791
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Derl2 A G 11: 71,018,938 probably benign Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 AG A 19: 5,608,269 probably null Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Myt1 A G 2: 181,767,705 probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Fut11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0733:Fut11 UTSW 14 20695359 nonsense probably null
R1524:Fut11 UTSW 14 20696166 missense possibly damaging 0.89
R5087:Fut11 UTSW 14 20696161 missense probably damaging 1.00
R5512:Fut11 UTSW 14 20696001 missense probably damaging 1.00
R5773:Fut11 UTSW 14 20698315 missense probably damaging 0.99
R6466:Fut11 UTSW 14 20695309 missense probably damaging 0.99
R7632:Fut11 UTSW 14 20695028 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCCCTCAAAAGTTGGCAGAG -3'
(R):5'- AAGCAAGCAGTTTGATTTGGC -3'

Sequencing Primer
(F):5'- CCCTCAAAAGTTGGCAGAGTTTATTG -3'
(R):5'- CAAGCAGTTTGATTTGGCAGCTG -3'
Posted On2019-09-13