Incidental Mutation 'R7386:Pygo2'
ID573081
Institutional Source Beutler Lab
Gene Symbol Pygo2
Ensembl Gene ENSMUSG00000047824
Gene Namepygopus 2
Synonyms1190004M21Rik, mpygo2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7386 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89430214-89435128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89432821 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 175 (F175L)
Ref Sequence ENSEMBL: ENSMUSP00000053672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000039110] [ENSMUST00000060061] [ENSMUST00000094378] [ENSMUST00000107413] [ENSMUST00000107417] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630] [ENSMUST00000191485]
Predicted Effect probably benign
Transcript: ENSMUST00000038942
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039110
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060061
AA Change: F175L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053672
Gene: ENSMUSG00000047824
AA Change: F175L

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Blast:SH2 52 78 1e-9 BLAST
low complexity region 115 163 N/A INTRINSIC
low complexity region 177 193 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
PHD 328 382 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094378
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107413
AA Change: F138L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103036
Gene: ENSMUSG00000047824
AA Change: F138L

DomainStartEndE-ValueType
Blast:SH2 15 41 1e-9 BLAST
low complexity region 78 126 N/A INTRINSIC
low complexity region 140 156 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
low complexity region 272 287 N/A INTRINSIC
PHD 291 345 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107417
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Predicted Effect probably benign
Transcript: ENSMUST00000191485
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, have small or absent lens, abnormal optic cup morphology, and impaired mammary gland epithelium proliferation. Mice homozygous for a knock-in allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,137 M2K unknown Het
6430531B16Rik A T 7: 139,976,052 C225* probably null Het
Ablim3 T C 18: 61,821,994 D308G probably damaging Het
Adamts17 A T 7: 66,968,849 K370N probably benign Het
Adcy4 T C 14: 55,778,327 Y435C probably damaging Het
Adgb A T 10: 10,377,949 F1216I possibly damaging Het
Akr1a1 G A 4: 116,641,054 T98I probably damaging Het
Alyref2 G T 1: 171,503,533 probably benign Het
Ank3 T A 10: 69,822,249 H168Q unknown Het
Bnc1 A C 7: 81,974,492 L329R possibly damaging Het
Btaf1 G A 19: 36,958,382 A191T probably benign Het
Carmil3 T G 14: 55,497,747 probably null Het
Cd200r1 C A 16: 44,789,848 D143E probably benign Het
Cep112 A G 11: 108,808,681 H98R probably benign Het
Cmya5 T A 13: 93,069,323 Q3346L probably damaging Het
Cpne4 T A 9: 104,872,740 V81E possibly damaging Het
Ctnnd2 T A 15: 30,966,768 M955K probably damaging Het
Ctsj A T 13: 61,000,559 M307K possibly damaging Het
Ddhd2 G T 8: 25,754,290 R103S possibly damaging Het
Depdc5 A G 5: 32,927,936 T700A probably benign Het
Dhx57 A C 17: 80,267,577 D657E possibly damaging Het
Dmbt1 G A 7: 131,112,236 G1678S unknown Het
Dnajb1 A G 8: 83,610,303 D234G probably benign Het
Dsc2 C T 18: 20,041,926 V431M possibly damaging Het
Foxo3 T C 10: 42,197,360 D387G probably benign Het
Gda A G 19: 21,409,886 I325T probably benign Het
Gm960 G A 19: 4,663,558 R285* probably null Het
Iqgap1 A G 7: 80,726,042 S1362P probably damaging Het
Klf10 G T 15: 38,296,949 N282K possibly damaging Het
Mettl13 A G 1: 162,548,154 Y35H probably damaging Het
Mill2 A G 7: 18,858,290 T279A probably benign Het
Ncaph2 G A 15: 89,370,256 W386* probably null Het
Nploc4 A T 11: 120,408,881 S338T probably benign Het
Nrip1 T C 16: 76,293,887 S261G probably damaging Het
Olfr1042 A G 2: 86,159,530 V280A possibly damaging Het
Olfr1354 T A 10: 78,916,843 M1K probably null Het
Olfr1388 T C 11: 49,444,400 F183S possibly damaging Het
Palld A G 8: 61,532,052 F1060L unknown Het
Pfas C G 11: 69,003,774 V22L probably benign Het
Rnf2 T C 1: 151,471,380 E316G probably damaging Het
Rtn4 T A 11: 29,707,772 M642K probably damaging Het
Saa3 A G 7: 46,714,923 C60R unknown Het
Scap A G 9: 110,373,169 T202A probably benign Het
Scn9a T A 2: 66,540,550 D562V probably damaging Het
Slc6a19 A T 13: 73,689,891 V163E possibly damaging Het
Smc5 G A 19: 23,215,175 H850Y possibly damaging Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Sulf1 T C 1: 12,838,361 Y533H probably benign Het
Tex45 A G 8: 3,487,079 K475R probably benign Het
Thbs2 A G 17: 14,673,150 S923P possibly damaging Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem132c A G 5: 127,563,926 K1054E probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnrc6c T A 11: 117,721,954 C313S probably benign Het
Tpm1 T C 9: 67,028,167 I284M probably benign Het
Trpm4 A T 7: 45,314,640 L722H possibly damaging Het
Trub2 T G 2: 29,786,595 Q41P probably benign Het
Vgll1 TCCAGAGGTCTACCGTGTCTTTCCCGACAGGCATCTGACTCC TC X: 57,101,879 probably null Het
Zfp398 G A 6: 47,858,950 V148I probably benign Het
Zfp40 T C 17: 23,177,007 E202G probably damaging Het
Zfp618 T A 4: 63,095,385 probably null Het
Zfp667 T A 7: 6,305,950 I539N possibly damaging Het
Zfp738 A T 13: 67,670,250 C541S probably damaging Het
Other mutations in Pygo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Pygo2 APN 3 89432446 unclassified probably benign
R0147:Pygo2 UTSW 3 89433303 missense probably damaging 1.00
R0330:Pygo2 UTSW 3 89433154 missense possibly damaging 0.72
R2046:Pygo2 UTSW 3 89433148 missense possibly damaging 0.72
R4093:Pygo2 UTSW 3 89433264 missense probably damaging 0.98
R5341:Pygo2 UTSW 3 89432760 missense probably damaging 0.98
R7172:Pygo2 UTSW 3 89432636 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCCTTTGGAGGCTTTCGTGTAC -3'
(R):5'- GGGCTGATTCCCATTGACAG -3'

Sequencing Primer
(F):5'- CAGGTACCCCCAGGCTAC -3'
(R):5'- TGATTCCCATTGACAGCAGCAG -3'
Posted On2019-09-13