Mutagenetix > Incidental Mutation

Incidental Mutation 'R7386:Depdc5'

573084

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

045468-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7386 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32927936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 700 (T700A)

Ref Sequence

ENSEMBL: ENSMUSP00000113862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000195980]

AlphaFold

P61460

Predicted Effect

probably benign
Transcript: ENSMUST00000049780
AA Change: T700A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: T700A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087897
AA Change: T700A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: T700A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119705
AA Change: T700A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: T700A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120902
AA Change: T700A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: T700A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124780

SMART Domains

Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
low complexity region	179	189	N/A	INTRINSIC
low complexity region	347	359	N/A	INTRINSIC
SCOP:d1fsha_	519	586	1e-13	SMART
Blast:DEP	537	589	2e-24	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: T97A

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC
low complexity region	224	234	N/A	INTRINSIC
low complexity region	392	404	N/A	INTRINSIC
low complexity region	535	551	N/A	INTRINSIC
DEP	560	635	2.49e-15	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	896	910	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195980

SMART Domains

Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	147	4e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930546C10Rik	A	T	18: 68,950,137	M2K	unknown	Het
6430531B16Rik	A	T	7: 139,976,052	C225*	probably null	Het
Ablim3	T	C	18: 61,821,994	D308G	probably damaging	Het
Adamts17	A	T	7: 66,968,849	K370N	probably benign	Het
Adcy4	T	C	14: 55,778,327	Y435C	probably damaging	Het
Adgb	A	T	10: 10,377,949	F1216I	possibly damaging	Het
Akr1a1	G	A	4: 116,641,054	T98I	probably damaging	Het
Alyref2	G	T	1: 171,503,533		probably benign	Het
Ank3	T	A	10: 69,822,249	H168Q	unknown	Het
Bnc1	A	C	7: 81,974,492	L329R	possibly damaging	Het
Btaf1	G	A	19: 36,958,382	A191T	probably benign	Het
Carmil3	T	G	14: 55,497,747		probably null	Het
Cd200r1	C	A	16: 44,789,848	D143E	probably benign	Het
Cep112	A	G	11: 108,808,681	H98R	probably benign	Het
Cmya5	T	A	13: 93,069,323	Q3346L	probably damaging	Het
Cpne4	T	A	9: 104,872,740	V81E	possibly damaging	Het
Ctnnd2	T	A	15: 30,966,768	M955K	probably damaging	Het
Ctsj	A	T	13: 61,000,559	M307K	possibly damaging	Het
Ddhd2	G	T	8: 25,754,290	R103S	possibly damaging	Het
Dhx57	A	C	17: 80,267,577	D657E	possibly damaging	Het
Dmbt1	G	A	7: 131,112,236	G1678S	unknown	Het
Dnajb1	A	G	8: 83,610,303	D234G	probably benign	Het
Dsc2	C	T	18: 20,041,926	V431M	possibly damaging	Het
Evi5	C	A	5: 107,809,823		probably null	Het
Exoc2	T	C	13: 30,906,663		probably null	Het
Foxo3	T	C	10: 42,197,360	D387G	probably benign	Het
Gda	A	G	19: 21,409,886	I325T	probably benign	Het
Gm960	G	A	19: 4,663,558	R285*	probably null	Het
Iqgap1	A	G	7: 80,726,042	S1362P	probably damaging	Het
Klf10	G	T	15: 38,296,949	N282K	possibly damaging	Het
Mettl13	A	G	1: 162,548,154	Y35H	probably damaging	Het
Mill2	A	G	7: 18,858,290	T279A	probably benign	Het
Ncaph2	G	A	15: 89,370,256	W386*	probably null	Het
Nploc4	A	T	11: 120,408,881	S338T	probably benign	Het
Nrip1	T	C	16: 76,293,887	S261G	probably damaging	Het
Olfr1042	A	G	2: 86,159,530	V280A	possibly damaging	Het
Olfr1354	T	A	10: 78,916,843	M1K	probably null	Het
Olfr1388	T	C	11: 49,444,400	F183S	possibly damaging	Het
Palld	A	G	8: 61,532,052	F1060L	unknown	Het
Pfas	C	G	11: 69,003,774	V22L	probably benign	Het
Pygo2	T	G	3: 89,432,821	F175L	probably benign	Het
Rnf2	T	C	1: 151,471,380	E316G	probably damaging	Het
Rtn4	T	A	11: 29,707,772	M642K	probably damaging	Het
Saa3	A	G	7: 46,714,923	C60R	unknown	Het
Scap	A	G	9: 110,373,169	T202A	probably benign	Het
Scn9a	T	A	2: 66,540,550	D562V	probably damaging	Het
Slc6a19	A	T	13: 73,689,891	V163E	possibly damaging	Het
Smc5	G	A	19: 23,215,175	H850Y	possibly damaging	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Sulf1	T	C	1: 12,838,361	Y533H	probably benign	Het
Tex45	A	G	8: 3,487,079	K475R	probably benign	Het
Thbs2	A	G	17: 14,673,150	S923P	possibly damaging	Het
Themis	A	G	10: 28,789,747	D602G	probably benign	Het
Tmem132c	A	G	5: 127,563,926	K1054E	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnrc6c	T	A	11: 117,721,954	C313S	probably benign	Het
Tpm1	T	C	9: 67,028,167	I284M	probably benign	Het
Trpm4	A	T	7: 45,314,640	L722H	possibly damaging	Het
Trub2	T	G	2: 29,786,595	Q41P	probably benign	Het
Usp17le	A	C	7: 104,768,307		probably null	Het
Zfp398	G	A	6: 47,858,950	V148I	probably benign	Het
Zfp40	T	C	17: 23,177,007	E202G	probably damaging	Het
Zfp618	T	A	4: 63,095,385		probably null	Het
Zfp667	T	A	7: 6,305,950	I539N	possibly damaging	Het
Zfp738	A	T	13: 67,670,250	C541S	probably damaging	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCGTTTCCAATCCCATATGC -3'
(R):5'- TCTTGACCAACATGTTCTCAGC -3'

Sequencing Primer
(F):5'- TCTCCCATACACTAGGATACAGGGTG -3'
(R):5'- GCTAAAAATGTAATGTGCAGCCC -3'

Posted On

2019-09-13