Mutagenetix > Incidental Mutation

Incidental Mutation 'R7386:Adgb'

573103

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7386 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 10377949 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1216 (F1216I)

Ref Sequence

ENSEMBL: ENSMUSP00000136386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172530
AA Change: F1214I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: F1214I

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179956
AA Change: F1216I

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: F1216I

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208717
AA Change: F1190I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930546C10Rik	A	T	18: 68,950,137	M2K	unknown	Het
6430531B16Rik	A	T	7: 139,976,052	C225*	probably null	Het
Ablim3	T	C	18: 61,821,994	D308G	probably damaging	Het
Adamts17	A	T	7: 66,968,849	K370N	probably benign	Het
Adcy4	T	C	14: 55,778,327	Y435C	probably damaging	Het
Akr1a1	G	A	4: 116,641,054	T98I	probably damaging	Het
Alyref2	G	T	1: 171,503,533		probably benign	Het
Ank3	T	A	10: 69,822,249	H168Q	unknown	Het
Bnc1	A	C	7: 81,974,492	L329R	possibly damaging	Het
Btaf1	G	A	19: 36,958,382	A191T	probably benign	Het
Carmil3	T	G	14: 55,497,747		probably null	Het
Cd200r1	C	A	16: 44,789,848	D143E	probably benign	Het
Cep112	A	G	11: 108,808,681	H98R	probably benign	Het
Cmya5	T	A	13: 93,069,323	Q3346L	probably damaging	Het
Cpne4	T	A	9: 104,872,740	V81E	possibly damaging	Het
Ctnnd2	T	A	15: 30,966,768	M955K	probably damaging	Het
Ctsj	A	T	13: 61,000,559	M307K	possibly damaging	Het
Ddhd2	G	T	8: 25,754,290	R103S	possibly damaging	Het
Depdc5	A	G	5: 32,927,936	T700A	probably benign	Het
Dhx57	A	C	17: 80,267,577	D657E	possibly damaging	Het
Dmbt1	G	A	7: 131,112,236	G1678S	unknown	Het
Dnajb1	A	G	8: 83,610,303	D234G	probably benign	Het
Dsc2	C	T	18: 20,041,926	V431M	possibly damaging	Het
Evi5	C	A	5: 107,809,823		probably null	Het
Exoc2	T	C	13: 30,906,663		probably null	Het
Foxo3	T	C	10: 42,197,360	D387G	probably benign	Het
Gda	A	G	19: 21,409,886	I325T	probably benign	Het
Gm960	G	A	19: 4,663,558	R285*	probably null	Het
Iqgap1	A	G	7: 80,726,042	S1362P	probably damaging	Het
Klf10	G	T	15: 38,296,949	N282K	possibly damaging	Het
Mettl13	A	G	1: 162,548,154	Y35H	probably damaging	Het
Mill2	A	G	7: 18,858,290	T279A	probably benign	Het
Ncaph2	G	A	15: 89,370,256	W386*	probably null	Het
Nploc4	A	T	11: 120,408,881	S338T	probably benign	Het
Nrip1	T	C	16: 76,293,887	S261G	probably damaging	Het
Olfr1042	A	G	2: 86,159,530	V280A	possibly damaging	Het
Olfr1354	T	A	10: 78,916,843	M1K	probably null	Het
Olfr1388	T	C	11: 49,444,400	F183S	possibly damaging	Het
Palld	A	G	8: 61,532,052	F1060L	unknown	Het
Pfas	C	G	11: 69,003,774	V22L	probably benign	Het
Pygo2	T	G	3: 89,432,821	F175L	probably benign	Het
Rnf2	T	C	1: 151,471,380	E316G	probably damaging	Het
Rtn4	T	A	11: 29,707,772	M642K	probably damaging	Het
Saa3	A	G	7: 46,714,923	C60R	unknown	Het
Scap	A	G	9: 110,373,169	T202A	probably benign	Het
Scn9a	T	A	2: 66,540,550	D562V	probably damaging	Het
Slc6a19	A	T	13: 73,689,891	V163E	possibly damaging	Het
Smc5	G	A	19: 23,215,175	H850Y	possibly damaging	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Sulf1	T	C	1: 12,838,361	Y533H	probably benign	Het
Tex45	A	G	8: 3,487,079	K475R	probably benign	Het
Thbs2	A	G	17: 14,673,150	S923P	possibly damaging	Het
Themis	A	G	10: 28,789,747	D602G	probably benign	Het
Tmem132c	A	G	5: 127,563,926	K1054E	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnrc6c	T	A	11: 117,721,954	C313S	probably benign	Het
Tpm1	T	C	9: 67,028,167	I284M	probably benign	Het
Trpm4	A	T	7: 45,314,640	L722H	possibly damaging	Het
Trub2	T	G	2: 29,786,595	Q41P	probably benign	Het
Usp17le	A	C	7: 104,768,307		probably null	Het
Zfp398	G	A	6: 47,858,950	V148I	probably benign	Het
Zfp40	T	C	17: 23,177,007	E202G	probably damaging	Het
Zfp618	T	A	4: 63,095,385		probably null	Het
Zfp667	T	A	7: 6,305,950	I539N	possibly damaging	Het
Zfp738	A	T	13: 67,670,250	C541S	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGTGAATACAGGGCACTAGGGT -3'
(R):5'- CGAGATCCTGCTTTTATTCTTTAAGA -3'

Sequencing Primer
(F):5'- TCCAGGTTGGAGTTACACAC -3'
(R):5'- TGGGAACTGAACAAGGATCCTCTTC -3'

Posted On

2019-09-13