Incidental Mutation 'R7386:Slc6a19'
ID573116
Institutional Source Beutler Lab
Gene Symbol Slc6a19
Ensembl Gene ENSMUSG00000021565
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 19
SynonymsB<0>AT1, 4632401C08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7386 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73679745-73704865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73689891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 163 (V163E)
Ref Sequence ENSEMBL: ENSMUSP00000022048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000124406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022048
AA Change: V163E

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565
AA Change: V163E

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124406
SMART Domains Protein: ENSMUSP00000119313
Gene: ENSMUSG00000021565

DomainStartEndE-ValueType
Pfam:SNF 32 79 1.7e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a system B(0) transmembrane protein that actively transports most neutral amino acids across the apical membrane of epithelial cells. Mutations in this gene result in Hartnup disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and impaired amino acid absorption and excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,137 M2K unknown Het
6430531B16Rik A T 7: 139,976,052 C225* probably null Het
Ablim3 T C 18: 61,821,994 D308G probably damaging Het
Adamts17 A T 7: 66,968,849 K370N probably benign Het
Adcy4 T C 14: 55,778,327 Y435C probably damaging Het
Adgb A T 10: 10,377,949 F1216I possibly damaging Het
Akr1a1 G A 4: 116,641,054 T98I probably damaging Het
Alyref2 G T 1: 171,503,533 probably benign Het
Ank3 T A 10: 69,822,249 H168Q unknown Het
Bnc1 A C 7: 81,974,492 L329R possibly damaging Het
Btaf1 G A 19: 36,958,382 A191T probably benign Het
Carmil3 T G 14: 55,497,747 probably null Het
Cd200r1 C A 16: 44,789,848 D143E probably benign Het
Cep112 A G 11: 108,808,681 H98R probably benign Het
Cmya5 T A 13: 93,069,323 Q3346L probably damaging Het
Cpne4 T A 9: 104,872,740 V81E possibly damaging Het
Ctnnd2 T A 15: 30,966,768 M955K probably damaging Het
Ctsj A T 13: 61,000,559 M307K possibly damaging Het
Ddhd2 G T 8: 25,754,290 R103S possibly damaging Het
Depdc5 A G 5: 32,927,936 T700A probably benign Het
Dhx57 A C 17: 80,267,577 D657E possibly damaging Het
Dmbt1 G A 7: 131,112,236 G1678S unknown Het
Dnajb1 A G 8: 83,610,303 D234G probably benign Het
Dsc2 C T 18: 20,041,926 V431M possibly damaging Het
Evi5 C A 5: 107,809,823 probably null Het
Exoc2 T C 13: 30,906,663 probably null Het
Foxo3 T C 10: 42,197,360 D387G probably benign Het
Gda A G 19: 21,409,886 I325T probably benign Het
Gm960 G A 19: 4,663,558 R285* probably null Het
Iqgap1 A G 7: 80,726,042 S1362P probably damaging Het
Klf10 G T 15: 38,296,949 N282K possibly damaging Het
Mettl13 A G 1: 162,548,154 Y35H probably damaging Het
Mill2 A G 7: 18,858,290 T279A probably benign Het
Ncaph2 G A 15: 89,370,256 W386* probably null Het
Nploc4 A T 11: 120,408,881 S338T probably benign Het
Nrip1 T C 16: 76,293,887 S261G probably damaging Het
Olfr1042 A G 2: 86,159,530 V280A possibly damaging Het
Olfr1354 T A 10: 78,916,843 M1K probably null Het
Olfr1388 T C 11: 49,444,400 F183S possibly damaging Het
Palld A G 8: 61,532,052 F1060L unknown Het
Pfas C G 11: 69,003,774 V22L probably benign Het
Pygo2 T G 3: 89,432,821 F175L probably benign Het
Rnf2 T C 1: 151,471,380 E316G probably damaging Het
Rtn4 T A 11: 29,707,772 M642K probably damaging Het
Saa3 A G 7: 46,714,923 C60R unknown Het
Scap A G 9: 110,373,169 T202A probably benign Het
Scn9a T A 2: 66,540,550 D562V probably damaging Het
Smc5 G A 19: 23,215,175 H850Y possibly damaging Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Sulf1 T C 1: 12,838,361 Y533H probably benign Het
Tex45 A G 8: 3,487,079 K475R probably benign Het
Thbs2 A G 17: 14,673,150 S923P possibly damaging Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem132c A G 5: 127,563,926 K1054E probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnrc6c T A 11: 117,721,954 C313S probably benign Het
Tpm1 T C 9: 67,028,167 I284M probably benign Het
Trpm4 A T 7: 45,314,640 L722H possibly damaging Het
Trub2 T G 2: 29,786,595 Q41P probably benign Het
Usp17le A C 7: 104,768,307 probably null Het
Zfp398 G A 6: 47,858,950 V148I probably benign Het
Zfp40 T C 17: 23,177,007 E202G probably damaging Het
Zfp618 T A 4: 63,095,385 probably null Het
Zfp667 T A 7: 6,305,950 I539N possibly damaging Het
Zfp738 A T 13: 67,670,250 C541S probably damaging Het
Other mutations in Slc6a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Slc6a19 APN 13 73700590 missense probably damaging 1.00
IGL02425:Slc6a19 APN 13 73691800 missense probably benign 0.00
IGL03030:Slc6a19 APN 13 73700471 missense probably damaging 1.00
IGL03067:Slc6a19 APN 13 73689730 nonsense probably null
IGL03216:Slc6a19 APN 13 73686181 missense probably benign
IGL03330:Slc6a19 APN 13 73689560 missense possibly damaging 0.95
H8562:Slc6a19 UTSW 13 73700124 intron probably benign
R0107:Slc6a19 UTSW 13 73684057 missense possibly damaging 0.93
R0446:Slc6a19 UTSW 13 73691695 missense probably benign 0.01
R1422:Slc6a19 UTSW 13 73685869 missense probably benign 0.05
R1443:Slc6a19 UTSW 13 73684344 missense probably damaging 1.00
R1501:Slc6a19 UTSW 13 73684048 missense probably benign 0.08
R1564:Slc6a19 UTSW 13 73686124 missense probably damaging 1.00
R1632:Slc6a19 UTSW 13 73689908 splice site probably null
R1832:Slc6a19 UTSW 13 73692950 missense probably benign
R2077:Slc6a19 UTSW 13 73700566 missense probably benign
R4418:Slc6a19 UTSW 13 73684395 missense possibly damaging 0.93
R4486:Slc6a19 UTSW 13 73681717 missense probably damaging 0.98
R4510:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4511:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4803:Slc6a19 UTSW 13 73684042 missense possibly damaging 0.91
R4965:Slc6a19 UTSW 13 73700558 missense probably benign 0.00
R4988:Slc6a19 UTSW 13 73685840 nonsense probably null
R5085:Slc6a19 UTSW 13 73691753 missense probably benign 0.11
R5533:Slc6a19 UTSW 13 73685829 missense possibly damaging 0.67
R5851:Slc6a19 UTSW 13 73691740 missense possibly damaging 0.55
R5874:Slc6a19 UTSW 13 73684368 missense probably damaging 0.98
R6074:Slc6a19 UTSW 13 73689763 missense probably benign 0.00
R6608:Slc6a19 UTSW 13 73683972 missense probably damaging 1.00
R7275:Slc6a19 UTSW 13 73686078 missense probably benign 0.11
R7388:Slc6a19 UTSW 13 73693084 missense probably benign 0.30
R7393:Slc6a19 UTSW 13 73692974 missense probably benign 0.00
Z1088:Slc6a19 UTSW 13 73689730 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CATACTGCACCTTCCCAGTG -3'
(R):5'- ACAAACAAGTGTGCACATGC -3'

Sequencing Primer
(F):5'- TGGTCTCGATGCCACGGATAATAC -3'
(R):5'- CAGATGTGTGGGTGTATTCACAAG -3'
Posted On2019-09-13