Incidental Mutation 'R7386:Ncaph2'
ID573124
Institutional Source Beutler Lab
Gene Symbol Ncaph2
Ensembl Gene ENSMUSG00000008690
Gene Namenon-SMC condensin II complex, subunit H2
SynonymsKleisin beta, D15Ertd785e, 2610524G04Rik, 0610010J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R7386 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89355719-89372826 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 89370256 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 386 (W386*)
Ref Sequence ENSEMBL: ENSMUSP00000086095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000228977]
Predicted Effect probably benign
Transcript: ENSMUST00000023285
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036987
AA Change: W355*
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690
AA Change: W355*

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074552
AA Change: W386*
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690
AA Change: W386*

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088717
AA Change: W386*
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690
AA Change: W386*

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a component of the condensin-2 complex. The encoded protein may regulate the structure of mitotic chromosomes. Loss of function of this gene disrupts T-cell development. There are two pseudogenes for this gene on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for an ENU-induced single point mutation display a specific defect in T cell development but are otherwise viable, fertile and overtly healthy with no apparent defects in B cell development. Homozygous null mice die before E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,137 M2K unknown Het
6430531B16Rik A T 7: 139,976,052 C225* probably null Het
Ablim3 T C 18: 61,821,994 D308G probably damaging Het
Adamts17 A T 7: 66,968,849 K370N probably benign Het
Adcy4 T C 14: 55,778,327 Y435C probably damaging Het
Adgb A T 10: 10,377,949 F1216I possibly damaging Het
Akr1a1 G A 4: 116,641,054 T98I probably damaging Het
Alyref2 G T 1: 171,503,533 probably benign Het
Ank3 T A 10: 69,822,249 H168Q unknown Het
Bnc1 A C 7: 81,974,492 L329R possibly damaging Het
Btaf1 G A 19: 36,958,382 A191T probably benign Het
Carmil3 T G 14: 55,497,747 probably null Het
Cd200r1 C A 16: 44,789,848 D143E probably benign Het
Cep112 A G 11: 108,808,681 H98R probably benign Het
Cmya5 T A 13: 93,069,323 Q3346L probably damaging Het
Cpne4 T A 9: 104,872,740 V81E possibly damaging Het
Ctnnd2 T A 15: 30,966,768 M955K probably damaging Het
Ctsj A T 13: 61,000,559 M307K possibly damaging Het
Ddhd2 G T 8: 25,754,290 R103S possibly damaging Het
Depdc5 A G 5: 32,927,936 T700A probably benign Het
Dhx57 A C 17: 80,267,577 D657E possibly damaging Het
Dmbt1 G A 7: 131,112,236 G1678S unknown Het
Dnajb1 A G 8: 83,610,303 D234G probably benign Het
Dsc2 C T 18: 20,041,926 V431M possibly damaging Het
Evi5 C A 5: 107,809,823 probably null Het
Exoc2 T C 13: 30,906,663 probably null Het
Foxo3 T C 10: 42,197,360 D387G probably benign Het
Gda A G 19: 21,409,886 I325T probably benign Het
Gm960 G A 19: 4,663,558 R285* probably null Het
Iqgap1 A G 7: 80,726,042 S1362P probably damaging Het
Klf10 G T 15: 38,296,949 N282K possibly damaging Het
Mettl13 A G 1: 162,548,154 Y35H probably damaging Het
Mill2 A G 7: 18,858,290 T279A probably benign Het
Nploc4 A T 11: 120,408,881 S338T probably benign Het
Nrip1 T C 16: 76,293,887 S261G probably damaging Het
Olfr1042 A G 2: 86,159,530 V280A possibly damaging Het
Olfr1354 T A 10: 78,916,843 M1K probably null Het
Olfr1388 T C 11: 49,444,400 F183S possibly damaging Het
Palld A G 8: 61,532,052 F1060L unknown Het
Pfas C G 11: 69,003,774 V22L probably benign Het
Pygo2 T G 3: 89,432,821 F175L probably benign Het
Rnf2 T C 1: 151,471,380 E316G probably damaging Het
Rtn4 T A 11: 29,707,772 M642K probably damaging Het
Saa3 A G 7: 46,714,923 C60R unknown Het
Scap A G 9: 110,373,169 T202A probably benign Het
Scn9a T A 2: 66,540,550 D562V probably damaging Het
Slc6a19 A T 13: 73,689,891 V163E possibly damaging Het
Smc5 G A 19: 23,215,175 H850Y possibly damaging Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Sulf1 T C 1: 12,838,361 Y533H probably benign Het
Tex45 A G 8: 3,487,079 K475R probably benign Het
Thbs2 A G 17: 14,673,150 S923P possibly damaging Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem132c A G 5: 127,563,926 K1054E probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnrc6c T A 11: 117,721,954 C313S probably benign Het
Tpm1 T C 9: 67,028,167 I284M probably benign Het
Trpm4 A T 7: 45,314,640 L722H possibly damaging Het
Trub2 T G 2: 29,786,595 Q41P probably benign Het
Usp17le A C 7: 104,768,307 probably null Het
Zfp398 G A 6: 47,858,950 V148I probably benign Het
Zfp40 T C 17: 23,177,007 E202G probably damaging Het
Zfp618 T A 4: 63,095,385 probably null Het
Zfp667 T A 7: 6,305,950 I539N possibly damaging Het
Zfp738 A T 13: 67,670,250 C541S probably damaging Het
Other mutations in Ncaph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Ncaph2 APN 15 89370040 missense probably damaging 1.00
IGL01640:Ncaph2 APN 15 89363838 splice site probably null
IGL02550:Ncaph2 APN 15 89369861 nonsense probably null
IGL02884:Ncaph2 APN 15 89364244 critical splice donor site probably null
IGL03369:Ncaph2 APN 15 89363655 missense probably benign 0.43
R0051:Ncaph2 UTSW 15 89369664 missense probably damaging 0.98
R0051:Ncaph2 UTSW 15 89369664 missense probably damaging 0.98
R0384:Ncaph2 UTSW 15 89369391 missense probably benign 0.00
R1677:Ncaph2 UTSW 15 89371224 missense probably damaging 1.00
R1680:Ncaph2 UTSW 15 89364622 missense probably benign
R2570:Ncaph2 UTSW 15 89370475 missense probably benign 0.03
R4647:Ncaph2 UTSW 15 89370432 missense probably damaging 1.00
R4731:Ncaph2 UTSW 15 89355827 unclassified probably benign
R4795:Ncaph2 UTSW 15 89370807 missense probably damaging 1.00
R4796:Ncaph2 UTSW 15 89370807 missense probably damaging 1.00
R4917:Ncaph2 UTSW 15 89360371 missense probably damaging 1.00
R5089:Ncaph2 UTSW 15 89355945 critical splice donor site probably null
R6143:Ncaph2 UTSW 15 89364003 critical splice donor site probably null
R6500:Ncaph2 UTSW 15 89364204 missense probably benign 0.00
R6768:Ncaph2 UTSW 15 89363999 nonsense probably null
R6827:Ncaph2 UTSW 15 89371327 missense probably damaging 1.00
R7033:Ncaph2 UTSW 15 89371356 missense probably benign 0.00
R7272:Ncaph2 UTSW 15 89364182 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCCCAGATGCTGAACACC -3'
(R):5'- TAGGCCACAGATCCTGCTTG -3'

Sequencing Primer
(F):5'- AGATGCTGAACACCCTGACGG -3'
(R):5'- AGATCCTGCTTGGCCCCAG -3'
Posted On2019-09-13