Mutagenetix > Incidental Mutations

Incidental Mutation 'R7386:Dhx57'

573129

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R7386 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 80267577 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 657 (D657E)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038166
AA Change: D604E

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: D604E

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086555
AA Change: D657E

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: D657E

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (66/66)

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930546C10Rik	A	T	18: 68,950,137	M2K	unknown	Het
6430531B16Rik	A	T	7: 139,976,052	C225*	probably null	Het
Ablim3	T	C	18: 61,821,994	D308G	probably damaging	Het
Adamts17	A	T	7: 66,968,849	K370N	probably benign	Het
Adcy4	T	C	14: 55,778,327	Y435C	probably damaging	Het
Adgb	A	T	10: 10,377,949	F1216I	possibly damaging	Het
Akr1a1	G	A	4: 116,641,054	T98I	probably damaging	Het
Alyref2	G	T	1: 171,503,533		probably benign	Het
Ank3	T	A	10: 69,822,249	H168Q	unknown	Het
Bnc1	A	C	7: 81,974,492	L329R	possibly damaging	Het
Btaf1	G	A	19: 36,958,382	A191T	probably benign	Het
Carmil3	T	G	14: 55,497,747		probably null	Het
Cd200r1	C	A	16: 44,789,848	D143E	probably benign	Het
Cep112	A	G	11: 108,808,681	H98R	probably benign	Het
Cmya5	T	A	13: 93,069,323	Q3346L	probably damaging	Het
Cpne4	T	A	9: 104,872,740	V81E	possibly damaging	Het
Ctnnd2	T	A	15: 30,966,768	M955K	probably damaging	Het
Ctsj	A	T	13: 61,000,559	M307K	possibly damaging	Het
Ddhd2	G	T	8: 25,754,290	R103S	possibly damaging	Het
Depdc5	A	G	5: 32,927,936	T700A	probably benign	Het
Dmbt1	G	A	7: 131,112,236	G1678S	unknown	Het
Dnajb1	A	G	8: 83,610,303	D234G	probably benign	Het
Dsc2	C	T	18: 20,041,926	V431M	possibly damaging	Het
Evi5	C	A	5: 107,809,823		probably null	Het
Exoc2	T	C	13: 30,906,663		probably null	Het
Foxo3	T	C	10: 42,197,360	D387G	probably benign	Het
Gda	A	G	19: 21,409,886	I325T	probably benign	Het
Gm960	G	A	19: 4,663,558	R285*	probably null	Het
Iqgap1	A	G	7: 80,726,042	S1362P	probably damaging	Het
Klf10	G	T	15: 38,296,949	N282K	possibly damaging	Het
Mettl13	A	G	1: 162,548,154	Y35H	probably damaging	Het
Mill2	A	G	7: 18,858,290	T279A	probably benign	Het
Ncaph2	G	A	15: 89,370,256	W386*	probably null	Het
Nploc4	A	T	11: 120,408,881	S338T	probably benign	Het
Nrip1	T	C	16: 76,293,887	S261G	probably damaging	Het
Olfr1042	A	G	2: 86,159,530	V280A	possibly damaging	Het
Olfr1354	T	A	10: 78,916,843	M1K	probably null	Het
Olfr1388	T	C	11: 49,444,400	F183S	possibly damaging	Het
Palld	A	G	8: 61,532,052	F1060L	unknown	Het
Pfas	C	G	11: 69,003,774	V22L	probably benign	Het
Pygo2	T	G	3: 89,432,821	F175L	probably benign	Het
Rnf2	T	C	1: 151,471,380	E316G	probably damaging	Het
Rtn4	T	A	11: 29,707,772	M642K	probably damaging	Het
Saa3	A	G	7: 46,714,923	C60R	unknown	Het
Scap	A	G	9: 110,373,169	T202A	probably benign	Het
Scn9a	T	A	2: 66,540,550	D562V	probably damaging	Het
Slc6a19	A	T	13: 73,689,891	V163E	possibly damaging	Het
Smc5	G	A	19: 23,215,175	H850Y	possibly damaging	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Sulf1	T	C	1: 12,838,361	Y533H	probably benign	Het
Tex45	A	G	8: 3,487,079	K475R	probably benign	Het
Thbs2	A	G	17: 14,673,150	S923P	possibly damaging	Het
Themis	A	G	10: 28,789,747	D602G	probably benign	Het
Tmem132c	A	G	5: 127,563,926	K1054E	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnrc6c	T	A	11: 117,721,954	C313S	probably benign	Het
Tpm1	T	C	9: 67,028,167	I284M	probably benign	Het
Trpm4	A	T	7: 45,314,640	L722H	possibly damaging	Het
Trub2	T	G	2: 29,786,595	Q41P	probably benign	Het
Usp17le	A	C	7: 104,768,307		probably null	Het
Zfp398	G	A	6: 47,858,950	V148I	probably benign	Het
Zfp40	T	C	17: 23,177,007	E202G	probably damaging	Het
Zfp618	T	A	4: 63,095,385		probably null	Het
Zfp667	T	A	7: 6,305,950	I539N	possibly damaging	Het
Zfp738	A	T	13: 67,670,250	C541S	probably damaging	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CACTGTGCTTCCAACCTTCAAG -3'
(R):5'- GGCTGACCTTAGTTAGAAGCTAC -3'

Sequencing Primer
(F):5'- TGTGCTTCCAACCTTCAAGATCAAG -3'
(R):5'- GTTCAGTTTTGCTTGCCAA -3'

Posted On

2019-09-13