Incidental Mutation 'R7386:Dsc2'
ID 573130
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 045468-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7386 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20174983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 431 (V431M)
Ref Sequence ENSEMBL: ENSMUSP00000042905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect possibly damaging
Transcript: ENSMUST00000039247
AA Change: V431M

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: V431M

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: V431M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: V431M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 69,083,208 (GRCm39) M2K unknown Het
Ablim3 T C 18: 61,955,065 (GRCm39) D308G probably damaging Het
Adamts17 A T 7: 66,618,597 (GRCm39) K370N probably benign Het
Adcy4 T C 14: 56,015,784 (GRCm39) Y435C probably damaging Het
Adgb A T 10: 10,253,693 (GRCm39) F1216I possibly damaging Het
Akr1a1 G A 4: 116,498,251 (GRCm39) T98I probably damaging Het
Alyref2 G T 1: 171,331,101 (GRCm39) probably benign Het
Ank3 T A 10: 69,658,079 (GRCm39) H168Q unknown Het
Bnc1 A C 7: 81,624,240 (GRCm39) L329R possibly damaging Het
Btaf1 G A 19: 36,935,782 (GRCm39) A191T probably benign Het
Carmil3 T G 14: 55,735,204 (GRCm39) probably null Het
Cd200r1 C A 16: 44,610,211 (GRCm39) D143E probably benign Het
Cep112 A G 11: 108,699,507 (GRCm39) H98R probably benign Het
Cmya5 T A 13: 93,205,831 (GRCm39) Q3346L probably damaging Het
Cpne4 T A 9: 104,749,939 (GRCm39) V81E possibly damaging Het
Ctnnd2 T A 15: 30,966,914 (GRCm39) M955K probably damaging Het
Ctsj A T 13: 61,148,373 (GRCm39) M307K possibly damaging Het
Ddhd2 G T 8: 26,244,318 (GRCm39) R103S possibly damaging Het
Depdc5 A G 5: 33,085,280 (GRCm39) T700A probably benign Het
Dhx57 A C 17: 80,575,006 (GRCm39) D657E possibly damaging Het
Dmbt1 G A 7: 130,713,965 (GRCm39) G1678S unknown Het
Dnajb1 A G 8: 84,336,932 (GRCm39) D234G probably benign Het
Evi5 C A 5: 107,957,689 (GRCm39) probably null Het
Exoc2 T C 13: 31,090,646 (GRCm39) probably null Het
Foxo3 T C 10: 42,073,356 (GRCm39) D387G probably benign Het
Gda A G 19: 21,387,250 (GRCm39) I325T probably benign Het
Iqgap1 A G 7: 80,375,790 (GRCm39) S1362P probably damaging Het
Klf10 G T 15: 38,297,193 (GRCm39) N282K possibly damaging Het
Mettl13 A G 1: 162,375,723 (GRCm39) Y35H probably damaging Het
Mill2 A G 7: 18,592,215 (GRCm39) T279A probably benign Het
Ncaph2 G A 15: 89,254,459 (GRCm39) W386* probably null Het
Nploc4 A T 11: 120,299,707 (GRCm39) S338T probably benign Het
Nrip1 T C 16: 76,090,775 (GRCm39) S261G probably damaging Het
Or2y16 T C 11: 49,335,227 (GRCm39) F183S possibly damaging Het
Or5al1 A G 2: 85,989,874 (GRCm39) V280A possibly damaging Het
Or7a38 T A 10: 78,752,677 (GRCm39) M1K probably null Het
Palld A G 8: 61,985,086 (GRCm39) F1060L unknown Het
Pfas C G 11: 68,894,600 (GRCm39) V22L probably benign Het
Pygo2 T G 3: 89,340,128 (GRCm39) F175L probably benign Het
Rnf2 T C 1: 151,347,131 (GRCm39) E316G probably damaging Het
Rtn4 T A 11: 29,657,772 (GRCm39) M642K probably damaging Het
Saa3 A G 7: 46,364,347 (GRCm39) C60R unknown Het
Saxo5 A G 8: 3,537,079 (GRCm39) K475R probably benign Het
Scap A G 9: 110,202,237 (GRCm39) T202A probably benign Het
Scn9a T A 2: 66,370,894 (GRCm39) D562V probably damaging Het
Slc6a19 A T 13: 73,838,010 (GRCm39) V163E possibly damaging Het
Smc5 G A 19: 23,192,539 (GRCm39) H850Y possibly damaging Het
Spef1l A T 7: 139,555,965 (GRCm39) C225* probably null Het
Sqle G A 15: 59,202,603 (GRCm39) R519Q probably benign Het
Sulf1 T C 1: 12,908,585 (GRCm39) Y533H probably benign Het
Thbs2 A G 17: 14,893,412 (GRCm39) S923P possibly damaging Het
Themis A G 10: 28,665,743 (GRCm39) D602G probably benign Het
Tmem132c A G 5: 127,640,990 (GRCm39) K1054E probably benign Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnrc6c T A 11: 117,612,780 (GRCm39) C313S probably benign Het
Top6bl G A 19: 4,713,586 (GRCm39) R285* probably null Het
Tpm1 T C 9: 66,935,449 (GRCm39) I284M probably benign Het
Trpm4 A T 7: 44,964,064 (GRCm39) L722H possibly damaging Het
Trub2 T G 2: 29,676,607 (GRCm39) Q41P probably benign Het
Usp17le A C 7: 104,417,514 (GRCm39) probably null Het
Zfp398 G A 6: 47,835,884 (GRCm39) V148I probably benign Het
Zfp40 T C 17: 23,395,981 (GRCm39) E202G probably damaging Het
Zfp618 T A 4: 63,013,622 (GRCm39) probably null Het
Zfp667 T A 7: 6,308,949 (GRCm39) I539N possibly damaging Het
Zfp738 A T 13: 67,818,369 (GRCm39) C541S probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCCACTGCTGCTTCTGG -3'
(R):5'- CACTGGATTTATTGAAAGCTCCC -3'

Sequencing Primer
(F):5'- GGTCTCTGGGTCATATGCCTTATATC -3'
(R):5'- GATTTATTGAAAGCTCCCCCACAATG -3'
Posted On 2019-09-13