Mutagenetix > Incidental Mutation

Incidental Mutation 'R7386:Dsc2'

573130

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7386 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20041926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 431 (V431M)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039247
AA Change: V431M

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: V431M

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: V431M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: V431M

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930546C10Rik	A	T	18: 68,950,137	M2K	unknown	Het
6430531B16Rik	A	T	7: 139,976,052	C225*	probably null	Het
Ablim3	T	C	18: 61,821,994	D308G	probably damaging	Het
Adamts17	A	T	7: 66,968,849	K370N	probably benign	Het
Adcy4	T	C	14: 55,778,327	Y435C	probably damaging	Het
Adgb	A	T	10: 10,377,949	F1216I	possibly damaging	Het
Akr1a1	G	A	4: 116,641,054	T98I	probably damaging	Het
Alyref2	G	T	1: 171,503,533		probably benign	Het
Ank3	T	A	10: 69,822,249	H168Q	unknown	Het
Bnc1	A	C	7: 81,974,492	L329R	possibly damaging	Het
Btaf1	G	A	19: 36,958,382	A191T	probably benign	Het
Carmil3	T	G	14: 55,497,747		probably null	Het
Cd200r1	C	A	16: 44,789,848	D143E	probably benign	Het
Cep112	A	G	11: 108,808,681	H98R	probably benign	Het
Cmya5	T	A	13: 93,069,323	Q3346L	probably damaging	Het
Cpne4	T	A	9: 104,872,740	V81E	possibly damaging	Het
Ctnnd2	T	A	15: 30,966,768	M955K	probably damaging	Het
Ctsj	A	T	13: 61,000,559	M307K	possibly damaging	Het
Ddhd2	G	T	8: 25,754,290	R103S	possibly damaging	Het
Depdc5	A	G	5: 32,927,936	T700A	probably benign	Het
Dhx57	A	C	17: 80,267,577	D657E	possibly damaging	Het
Dmbt1	G	A	7: 131,112,236	G1678S	unknown	Het
Dnajb1	A	G	8: 83,610,303	D234G	probably benign	Het
Evi5	C	A	5: 107,809,823		probably null	Het
Exoc2	T	C	13: 30,906,663		probably null	Het
Foxo3	T	C	10: 42,197,360	D387G	probably benign	Het
Gda	A	G	19: 21,409,886	I325T	probably benign	Het
Gm960	G	A	19: 4,663,558	R285*	probably null	Het
Iqgap1	A	G	7: 80,726,042	S1362P	probably damaging	Het
Klf10	G	T	15: 38,296,949	N282K	possibly damaging	Het
Mettl13	A	G	1: 162,548,154	Y35H	probably damaging	Het
Mill2	A	G	7: 18,858,290	T279A	probably benign	Het
Ncaph2	G	A	15: 89,370,256	W386*	probably null	Het
Nploc4	A	T	11: 120,408,881	S338T	probably benign	Het
Nrip1	T	C	16: 76,293,887	S261G	probably damaging	Het
Olfr1042	A	G	2: 86,159,530	V280A	possibly damaging	Het
Olfr1354	T	A	10: 78,916,843	M1K	probably null	Het
Olfr1388	T	C	11: 49,444,400	F183S	possibly damaging	Het
Palld	A	G	8: 61,532,052	F1060L	unknown	Het
Pfas	C	G	11: 69,003,774	V22L	probably benign	Het
Pygo2	T	G	3: 89,432,821	F175L	probably benign	Het
Rnf2	T	C	1: 151,471,380	E316G	probably damaging	Het
Rtn4	T	A	11: 29,707,772	M642K	probably damaging	Het
Saa3	A	G	7: 46,714,923	C60R	unknown	Het
Scap	A	G	9: 110,373,169	T202A	probably benign	Het
Scn9a	T	A	2: 66,540,550	D562V	probably damaging	Het
Slc6a19	A	T	13: 73,689,891	V163E	possibly damaging	Het
Smc5	G	A	19: 23,215,175	H850Y	possibly damaging	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Sulf1	T	C	1: 12,838,361	Y533H	probably benign	Het
Tex45	A	G	8: 3,487,079	K475R	probably benign	Het
Thbs2	A	G	17: 14,673,150	S923P	possibly damaging	Het
Themis	A	G	10: 28,789,747	D602G	probably benign	Het
Tmem132c	A	G	5: 127,563,926	K1054E	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnrc6c	T	A	11: 117,721,954	C313S	probably benign	Het
Tpm1	T	C	9: 67,028,167	I284M	probably benign	Het
Trpm4	A	T	7: 45,314,640	L722H	possibly damaging	Het
Trub2	T	G	2: 29,786,595	Q41P	probably benign	Het
Usp17le	A	C	7: 104,768,307		probably null	Het
Zfp398	G	A	6: 47,858,950	V148I	probably benign	Het
Zfp40	T	C	17: 23,177,007	E202G	probably damaging	Het
Zfp618	T	A	4: 63,095,385		probably null	Het
Zfp667	T	A	7: 6,305,950	I539N	possibly damaging	Het
Zfp738	A	T	13: 67,670,250	C541S	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGCCACTGCTGCTTCTGG -3'
(R):5'- CACTGGATTTATTGAAAGCTCCC -3'

Sequencing Primer
(F):5'- GGTCTCTGGGTCATATGCCTTATATC -3'
(R):5'- GATTTATTGAAAGCTCCCCCACAATG -3'

Posted On

2019-09-13