Incidental Mutation 'R7387:Lrp4'
ID573149
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Namelow density lipoprotein receptor-related protein 4
Synonymsmdig, Megf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R7387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91457511-91513779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91476614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 360 (V360A)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
Predicted Effect probably benign
Transcript: ENSMUST00000028689
AA Change: V360A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: V360A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cachd1 T C 4: 100,777,178 V17A unknown Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dnah6 G A 6: 73,212,612 Q18* probably null Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Ern1 A T 11: 106,421,952 V201E probably damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itga10 A T 3: 96,652,778 Q536L probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pkd1l1 T A 11: 8,901,203 Y1193F Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sec23ip C T 7: 128,745,003 probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1693:Lrp4 UTSW 2 91492353 missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91478678 splice site probably benign
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6657:Lrp4 UTSW 2 91492053 missense probably benign 0.00
R6696:Lrp4 UTSW 2 91497345 missense probably benign 0.03
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91511580 missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91494994 missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91492023 missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91473183 missense probably benign 0.04
R7585:Lrp4 UTSW 2 91492588 missense probably damaging 1.00
R7835:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7872:Lrp4 UTSW 2 91490716 missense possibly damaging 0.54
R7918:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7955:Lrp4 UTSW 2 91490716 missense possibly damaging 0.54
V7580:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACTGTCGTGAGTGTCTCTAGC -3'
(R):5'- ACCCATCTGATATGTCACCCAG -3'

Sequencing Primer
(F):5'- CCCTGCCCGTGGTTTGTG -3'
(R):5'- GATATGTCACCCAGCTTCCC -3'
Posted On2019-09-13