Incidental Mutation 'R7387:Itga10'
ID573154
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R7387 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96652778 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 536 (Q536L)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
AA Change: Q536L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: Q536L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119365
AA Change: Q536L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: Q536L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cachd1 T C 4: 100,777,178 V17A unknown Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dnah6 G A 6: 73,212,612 Q18* probably null Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Ern1 A T 11: 106,421,952 V201E probably damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrp4 T C 2: 91,476,614 V360A probably benign Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pkd1l1 T A 11: 8,901,203 Y1193F Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sec23ip C T 7: 128,745,003 probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R7976:Itga10 UTSW 3 96649612 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATATCTTACTTGTGGCGGCTC -3'
(R):5'- CTGATTCCAGTCTGGGTTCC -3'

Sequencing Primer
(F):5'- AGACCGGACGCGTTTATG -3'
(R):5'- CTGGGTTCCATGATACAGGTACAAC -3'
Posted On2019-09-13