Incidental Mutation 'R7387:Cenpe'
ID 573156
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, Kif10, N-7 kinesin, CENP-E
MMRRC Submission 045469-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7387 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 134918324-134979301 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 134952798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 1496 (M1496R)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: M1496R

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: M1496R

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,362,774 (GRCm39) Y182H probably damaging Het
Abca6 A G 11: 110,093,246 (GRCm39) V1009A probably benign Het
Abcg2 A T 6: 58,666,609 (GRCm39) I573F possibly damaging Het
Adck1 A G 12: 88,427,822 (GRCm39) T480A probably benign Het
Adcy5 T C 16: 35,092,460 (GRCm39) I607T probably damaging Het
Add2 A G 6: 86,062,997 (GRCm39) K52E probably damaging Het
Arid4a T A 12: 71,134,270 (GRCm39) S1191T probably damaging Het
Atg2a G T 19: 6,305,198 (GRCm39) C1207F possibly damaging Het
Atg2b T C 12: 105,589,034 (GRCm39) D1875G probably damaging Het
B3gntl1 A G 11: 121,520,741 (GRCm39) L224P possibly damaging Het
BC035947 A G 1: 78,475,098 (GRCm39) V478A possibly damaging Het
Cachd1 T C 4: 100,634,375 (GRCm39) V17A unknown Het
Cad T C 5: 31,219,284 (GRCm39) Y669H probably damaging Het
Ccdc110 A T 8: 46,395,233 (GRCm39) M375L probably benign Het
Cdc6 C T 11: 98,799,042 (GRCm39) probably benign Het
Cdhr4 T A 9: 107,874,111 (GRCm39) Y72* probably null Het
Clec4a1 T G 6: 122,899,016 (GRCm39) C28W possibly damaging Het
Cma2 A G 14: 56,210,505 (GRCm39) N120S probably benign Het
Cped1 A T 6: 22,059,933 (GRCm39) I200L probably benign Het
Cpsf1 A T 15: 76,486,766 (GRCm39) S257T possibly damaging Het
Dnah6 G A 6: 73,189,595 (GRCm39) Q18* probably null Het
Dpp10 T C 1: 123,268,869 (GRCm39) E720G probably benign Het
Dus2 G A 8: 106,772,619 (GRCm39) R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 (GRCm39) N769S possibly damaging Het
Ece1 T A 4: 137,666,095 (GRCm39) I313N possibly damaging Het
Ern1 A T 11: 106,312,778 (GRCm39) V201E probably damaging Het
Exoc3l A G 8: 106,021,605 (GRCm39) L141P probably damaging Het
Fam168b G A 1: 34,858,789 (GRCm39) T131M probably damaging Het
Fez1 T C 9: 36,779,108 (GRCm39) F262L probably damaging Het
H2-DMa T C 17: 34,357,101 (GRCm39) Y200H probably damaging Het
H2-Eb1 T A 17: 34,533,207 (GRCm39) V143D probably damaging Het
Ighv1-39 G A 12: 114,878,488 (GRCm39) P28S probably benign Het
Inka1 C T 9: 107,861,626 (GRCm39) R230H probably damaging Het
Iqgap1 C T 7: 80,370,738 (GRCm39) V1544I probably benign Het
Itga10 A T 3: 96,560,094 (GRCm39) Q536L probably benign Het
Itih2 C T 2: 10,135,319 (GRCm39) E24K possibly damaging Het
Itsn2 A T 12: 4,689,781 (GRCm39) N618I probably damaging Het
Kcnd2 T A 6: 21,216,777 (GRCm39) S160R probably benign Het
Kif11 T A 19: 37,398,204 (GRCm39) F677I probably damaging Het
Ldlrad2 C T 4: 137,301,828 (GRCm39) C18Y probably damaging Het
Lrp4 T C 2: 91,306,959 (GRCm39) V360A probably benign Het
Lrrtm2 T C 18: 35,346,025 (GRCm39) T426A probably damaging Het
Mcidas T C 13: 113,130,622 (GRCm39) F40L probably benign Het
Med27 T A 2: 29,303,419 (GRCm39) L123Q possibly damaging Het
Mettl2 T C 11: 105,023,364 (GRCm39) V249A probably benign Het
Mllt6 C A 11: 97,565,426 (GRCm39) A592D probably benign Het
Mrps5 C T 2: 127,442,804 (GRCm39) T291I probably damaging Het
Muc16 T A 9: 18,553,016 (GRCm39) T4426S probably benign Het
Myh1 A T 11: 67,099,715 (GRCm39) M542L probably benign Het
Nlrp12 G T 7: 3,289,831 (GRCm39) A227D probably damaging Het
Nlrp14 T C 7: 106,782,314 (GRCm39) Y504H probably damaging Het
Nr1i2 T C 16: 38,086,442 (GRCm39) S8G probably benign Het
Ntrk2 A G 13: 59,133,793 (GRCm39) K524R probably damaging Het
Nup210 C T 6: 90,998,378 (GRCm39) probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4c100 T A 2: 88,356,744 (GRCm39) Y272* probably null Het
Or52e4 T A 7: 104,706,297 (GRCm39) Y281* probably null Het
Or5h27 A T 16: 59,006,699 (GRCm39) I49N probably damaging Het
Patl1 A G 19: 11,911,094 (GRCm39) I525M probably benign Het
Pcnx3 A G 19: 5,723,364 (GRCm39) L1277P probably benign Het
Pelp1 G A 11: 70,287,425 (GRCm39) T461I probably damaging Het
Phf20 T C 2: 156,136,160 (GRCm39) C660R probably damaging Het
Pkd1l1 T A 11: 8,851,203 (GRCm39) Y1193F Het
Pknox2 G T 9: 36,868,364 (GRCm39) probably benign Het
Pml T C 9: 58,137,177 (GRCm39) T541A probably benign Het
Prss35 C T 9: 86,637,974 (GRCm39) T248I probably damaging Het
Rccd1 T A 7: 79,970,350 (GRCm39) N89I probably benign Het
Rcor3 T C 1: 191,821,824 (GRCm39) probably benign Het
Rreb1 A G 13: 38,131,040 (GRCm39) E16G unknown Het
Scgb2b12 T A 7: 32,026,060 (GRCm39) H44L probably benign Het
Sec23ip C T 7: 128,346,727 (GRCm39) probably benign Het
Sgsm1 A C 5: 113,411,566 (GRCm39) F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 (GRCm39) F116L possibly damaging Het
Spats2l T C 1: 57,941,293 (GRCm39) V253A probably damaging Het
Spopl A T 2: 23,427,521 (GRCm39) F204I probably benign Het
Sqle G A 15: 59,202,603 (GRCm39) R519Q probably benign Het
Stil T G 4: 114,881,233 (GRCm39) H592Q probably benign Het
Strip1 T A 3: 107,533,046 (GRCm39) S201C probably damaging Het
Tcp11l1 C A 2: 104,530,275 (GRCm39) A70S possibly damaging Het
Tmem163 T C 1: 127,447,180 (GRCm39) probably null Het
Tmem184c A T 8: 78,324,559 (GRCm39) Y310* probably null Het
Tmem30c T C 16: 57,090,386 (GRCm39) N274D probably benign Het
Trim30c T A 7: 104,039,397 (GRCm39) I133F probably damaging Het
Vars1 C T 17: 35,223,768 (GRCm39) Q228* probably null Het
Zdbf2 G A 1: 63,343,198 (GRCm39) V526I possibly damaging Het
Zfp819 T G 7: 43,262,065 (GRCm39) probably null Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 134,937,216 (GRCm39) critical splice donor site probably null
IGL00799:Cenpe APN 3 134,934,678 (GRCm39) critical splice donor site probably null
IGL00815:Cenpe APN 3 134,965,112 (GRCm39) missense probably benign
IGL01446:Cenpe APN 3 134,943,300 (GRCm39) missense probably benign 0.01
IGL01469:Cenpe APN 3 134,934,567 (GRCm39) missense probably damaging 1.00
IGL01843:Cenpe APN 3 134,924,268 (GRCm39) missense possibly damaging 0.88
IGL02254:Cenpe APN 3 134,961,238 (GRCm39) missense probably benign
IGL02337:Cenpe APN 3 134,926,037 (GRCm39) splice site probably benign
IGL02382:Cenpe APN 3 134,953,147 (GRCm39) missense probably benign
IGL02458:Cenpe APN 3 134,935,869 (GRCm39) nonsense probably null
IGL02934:Cenpe APN 3 134,970,112 (GRCm39) missense probably damaging 1.00
IGL03335:Cenpe APN 3 134,949,386 (GRCm39) missense probably benign
R0086:Cenpe UTSW 3 134,970,185 (GRCm39) splice site probably benign
R0173:Cenpe UTSW 3 134,965,744 (GRCm39) missense probably benign 0.00
R0394:Cenpe UTSW 3 134,922,186 (GRCm39) splice site probably benign
R0411:Cenpe UTSW 3 134,928,016 (GRCm39) missense probably damaging 1.00
R0624:Cenpe UTSW 3 134,952,347 (GRCm39) missense probably benign 0.00
R0634:Cenpe UTSW 3 134,952,588 (GRCm39) missense probably damaging 1.00
R0648:Cenpe UTSW 3 134,935,843 (GRCm39) missense probably damaging 1.00
R0691:Cenpe UTSW 3 134,923,066 (GRCm39) missense probably damaging 1.00
R1184:Cenpe UTSW 3 134,970,183 (GRCm39) critical splice donor site probably null
R1530:Cenpe UTSW 3 134,952,663 (GRCm39) missense possibly damaging 0.92
R1559:Cenpe UTSW 3 134,976,661 (GRCm39) missense probably benign 0.07
R1562:Cenpe UTSW 3 134,944,155 (GRCm39) missense possibly damaging 0.53
R1568:Cenpe UTSW 3 134,945,519 (GRCm39) missense probably benign 0.01
R1712:Cenpe UTSW 3 134,971,694 (GRCm39) missense probably damaging 0.99
R1828:Cenpe UTSW 3 134,952,257 (GRCm39) missense probably damaging 0.99
R1846:Cenpe UTSW 3 134,945,606 (GRCm39) missense probably damaging 1.00
R1861:Cenpe UTSW 3 134,974,740 (GRCm39) missense probably damaging 1.00
R1938:Cenpe UTSW 3 134,953,240 (GRCm39) missense probably damaging 0.98
R1961:Cenpe UTSW 3 134,948,254 (GRCm39) missense probably damaging 1.00
R2062:Cenpe UTSW 3 134,928,082 (GRCm39) splice site probably benign
R2118:Cenpe UTSW 3 134,952,645 (GRCm39) missense possibly damaging 0.94
R2127:Cenpe UTSW 3 134,945,541 (GRCm39) missense probably benign 0.08
R2156:Cenpe UTSW 3 134,953,235 (GRCm39) missense probably benign 0.34
R2265:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2268:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2392:Cenpe UTSW 3 134,953,874 (GRCm39) missense probably damaging 1.00
R2508:Cenpe UTSW 3 134,946,834 (GRCm39) missense possibly damaging 0.92
R3084:Cenpe UTSW 3 134,946,782 (GRCm39) missense probably damaging 1.00
R3779:Cenpe UTSW 3 134,962,337 (GRCm39) missense possibly damaging 0.87
R3833:Cenpe UTSW 3 134,928,083 (GRCm39) splice site probably benign
R3974:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R3975:Cenpe UTSW 3 134,944,233 (GRCm39) critical splice donor site probably null
R3975:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R4151:Cenpe UTSW 3 134,920,914 (GRCm39) missense probably benign 0.36
R4166:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R4581:Cenpe UTSW 3 134,952,761 (GRCm39) missense probably benign 0.30
R4622:Cenpe UTSW 3 134,949,469 (GRCm39) missense probably benign 0.22
R4692:Cenpe UTSW 3 134,922,140 (GRCm39) missense probably benign 0.29
R4769:Cenpe UTSW 3 134,953,912 (GRCm39) missense probably benign
R4976:Cenpe UTSW 3 134,940,637 (GRCm39) missense probably damaging 1.00
R4983:Cenpe UTSW 3 134,940,689 (GRCm39) missense probably damaging 1.00
R4990:Cenpe UTSW 3 134,962,401 (GRCm39) missense probably damaging 1.00
R5002:Cenpe UTSW 3 134,952,842 (GRCm39) missense probably benign
R5057:Cenpe UTSW 3 134,926,074 (GRCm39) missense probably benign 0.14
R5063:Cenpe UTSW 3 134,976,715 (GRCm39) missense probably damaging 0.99
R5181:Cenpe UTSW 3 134,948,064 (GRCm39) missense probably damaging 0.99
R5281:Cenpe UTSW 3 134,935,911 (GRCm39) missense possibly damaging 0.89
R5389:Cenpe UTSW 3 134,965,149 (GRCm39) critical splice donor site probably null
R5517:Cenpe UTSW 3 134,929,026 (GRCm39) missense probably damaging 1.00
R5521:Cenpe UTSW 3 134,974,826 (GRCm39) missense probably damaging 1.00
R5607:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5608:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5627:Cenpe UTSW 3 134,941,234 (GRCm39) missense possibly damaging 0.51
R5766:Cenpe UTSW 3 134,954,174 (GRCm39) missense probably damaging 0.96
R5783:Cenpe UTSW 3 134,967,341 (GRCm39) missense probably benign 0.00
R5933:Cenpe UTSW 3 134,967,389 (GRCm39) missense probably benign 0.03
R6073:Cenpe UTSW 3 134,965,834 (GRCm39) nonsense probably null
R6163:Cenpe UTSW 3 134,974,764 (GRCm39) missense probably damaging 0.99
R6192:Cenpe UTSW 3 134,954,291 (GRCm39) missense possibly damaging 0.93
R6224:Cenpe UTSW 3 134,949,536 (GRCm39) missense possibly damaging 0.87
R6313:Cenpe UTSW 3 134,935,936 (GRCm39) missense probably benign 0.26
R6326:Cenpe UTSW 3 134,945,539 (GRCm39) missense probably benign 0.15
R6383:Cenpe UTSW 3 134,957,289 (GRCm39) missense probably damaging 1.00
R6418:Cenpe UTSW 3 134,957,305 (GRCm39) missense probably damaging 0.99
R6797:Cenpe UTSW 3 134,943,899 (GRCm39) missense possibly damaging 0.92
R6810:Cenpe UTSW 3 134,949,583 (GRCm39) missense probably benign 0.00
R6989:Cenpe UTSW 3 134,940,888 (GRCm39) missense probably damaging 1.00
R7009:Cenpe UTSW 3 134,940,963 (GRCm39) missense probably benign 0.02
R7009:Cenpe UTSW 3 134,940,962 (GRCm39) missense probably damaging 0.97
R7039:Cenpe UTSW 3 134,961,217 (GRCm39) missense probably benign 0.28
R7470:Cenpe UTSW 3 134,947,916 (GRCm39) missense probably damaging 1.00
R7535:Cenpe UTSW 3 134,949,523 (GRCm39) missense possibly damaging 0.90
R7562:Cenpe UTSW 3 134,954,395 (GRCm39) missense probably damaging 1.00
R7573:Cenpe UTSW 3 134,953,220 (GRCm39) missense probably damaging 1.00
R7613:Cenpe UTSW 3 134,948,063 (GRCm39) missense possibly damaging 0.90
R7741:Cenpe UTSW 3 134,953,096 (GRCm39) splice site probably null
R7771:Cenpe UTSW 3 134,946,702 (GRCm39) splice site probably null
R7843:Cenpe UTSW 3 134,938,720 (GRCm39) nonsense probably null
R7973:Cenpe UTSW 3 134,929,011 (GRCm39) missense probably damaging 1.00
R8036:Cenpe UTSW 3 134,945,609 (GRCm39) frame shift probably null
R8069:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R8151:Cenpe UTSW 3 134,952,783 (GRCm39) missense probably benign 0.28
R8176:Cenpe UTSW 3 134,935,851 (GRCm39) missense probably damaging 1.00
R8191:Cenpe UTSW 3 134,957,375 (GRCm39) missense probably benign
R8251:Cenpe UTSW 3 134,957,445 (GRCm39) critical splice donor site probably null
R8425:Cenpe UTSW 3 134,948,388 (GRCm39) nonsense probably null
R8488:Cenpe UTSW 3 134,965,002 (GRCm39) missense probably damaging 1.00
R8811:Cenpe UTSW 3 134,929,001 (GRCm39) missense probably damaging 1.00
R8850:Cenpe UTSW 3 134,930,777 (GRCm39) missense probably damaging 1.00
R8879:Cenpe UTSW 3 134,965,862 (GRCm39) missense probably damaging 0.99
R8899:Cenpe UTSW 3 134,945,644 (GRCm39) missense probably benign 0.18
R9035:Cenpe UTSW 3 134,976,572 (GRCm39) missense probably benign 0.01
R9038:Cenpe UTSW 3 134,923,797 (GRCm39) missense probably benign 0.00
R9093:Cenpe UTSW 3 134,945,641 (GRCm39) nonsense probably null
R9221:Cenpe UTSW 3 134,935,839 (GRCm39) missense possibly damaging 0.90
R9365:Cenpe UTSW 3 134,954,207 (GRCm39) missense possibly damaging 0.56
R9443:Cenpe UTSW 3 134,976,609 (GRCm39) missense probably damaging 0.99
Z1177:Cenpe UTSW 3 134,922,146 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGTTCAAGAACTCTGTGAGAAACAG -3'
(R):5'- TTATGTAGCCACCCAGGTGC -3'

Sequencing Primer
(F):5'- CTTACTAGGAAAGAAACTAGCGAGGC -3'
(R):5'- CACCCAGGTGCACGTGAATAG -3'
Posted On 2019-09-13