Incidental Mutation 'R7387:Cachd1'
ID573158
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Namecache domain containing 1
SynonymsVwcd1, B430218L07Rik, 1190007F10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7387 (G1)
Quality Score102.008
Status Not validated
Chromosome4
Chromosomal Location100776675-101029220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100777178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000030257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
Predicted Effect unknown
Transcript: ENSMUST00000030257
AA Change: V17A
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000097955
AA Change: V17A
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dnah6 G A 6: 73,212,612 Q18* probably null Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Ern1 A T 11: 106,421,952 V201E probably damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itga10 A T 3: 96,652,778 Q536L probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrp4 T C 2: 91,476,614 V360A probably benign Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pkd1l1 T A 11: 8,901,203 Y1193F Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sec23ip C T 7: 128,745,003 probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100966966 missense probably benign 0.05
IGL01531:Cachd1 APN 4 100953034 missense probably benign 0.02
IGL01705:Cachd1 APN 4 100983539 missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100992872 missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100974128 missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100952097 missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100968098 missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100952085 missense probably damaging 0.98
IGL03084:Cachd1 APN 4 101003088 missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100994737 missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100953205 missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100897703 missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100994842 splice site probably benign
R0646:Cachd1 UTSW 4 100988221 missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100974876 missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100983301 splice site probably benign
R1156:Cachd1 UTSW 4 100988619 missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100974840 missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100974917 missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100988598 missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100966972 missense probably benign 0.02
R1774:Cachd1 UTSW 4 100964435 missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100967043 missense probably benign 0.02
R1845:Cachd1 UTSW 4 100777358 missense probably benign 0.01
R1869:Cachd1 UTSW 4 100983390 missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100953169 missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100990844 missense probably damaging 1.00
R2082:Cachd1 UTSW 4 101002958 missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100949069 splice site probably benign
R2517:Cachd1 UTSW 4 100980882 intron probably null
R2896:Cachd1 UTSW 4 100970903 missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100974880 nonsense probably null
R3818:Cachd1 UTSW 4 100990865 missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100970888 missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100953130 nonsense probably null
R4791:Cachd1 UTSW 4 100918085 missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100994738 missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100964491 missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100966200 missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100952122 missense probably damaging 0.98
R5335:Cachd1 UTSW 4 100968085 missense possibly damaging 0.88
R5390:Cachd1 UTSW 4 100981006 missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100974079 missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100865006 missense probably benign 0.31
R5905:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100952019 missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100981031 nonsense probably null
R6367:Cachd1 UTSW 4 101002970 missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100952118 missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100989486 missense probably benign
R6691:Cachd1 UTSW 4 100989486 missense probably benign
R7129:Cachd1 UTSW 4 100918066 missense probably null 0.99
R7187:Cachd1 UTSW 4 100976355 missense possibly damaging 0.95
R7833:Cachd1 UTSW 4 100974815 missense probably benign 0.09
R7838:Cachd1 UTSW 4 100967014 missense possibly damaging 0.71
R7867:Cachd1 UTSW 4 100988562 missense probably damaging 0.97
R7882:Cachd1 UTSW 4 100967047 missense probably benign 0.29
R7916:Cachd1 UTSW 4 100974815 missense probably benign 0.09
R7918:Cachd1 UTSW 4 100974153 splice site probably null
R7921:Cachd1 UTSW 4 100967014 missense possibly damaging 0.71
R7950:Cachd1 UTSW 4 100988562 missense probably damaging 0.97
R7965:Cachd1 UTSW 4 100967047 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAGTTTTCCAGCTACAGCCGC -3'
(R):5'- TGAAGTCTGCAGGAACCGAG -3'

Sequencing Primer
(F):5'- AGGAAAGTTTGGCGGGCTG -3'
(R):5'- GGTCGCTTACCTGCATGG -3'
Posted On2019-09-13