Incidental Mutation 'R7387:Dnah6'
ID573168
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Namedynein, axonemal, heavy chain 6
SynonymsA730004I20Rik, Dnahc6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7387 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location73017606-73221651 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 73212612 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 18 (Q18*)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
Predicted Effect probably null
Transcript: ENSMUST00000064948
AA Change: Q18*
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: Q18*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114040
AA Change: Q18*
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: Q18*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204053
AA Change: Q18*
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: Q18*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cachd1 T C 4: 100,777,178 V17A unknown Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Ern1 A T 11: 106,421,952 V201E probably damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itga10 A T 3: 96,652,778 Q536L probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrp4 T C 2: 91,476,614 V360A probably benign Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pkd1l1 T A 11: 8,901,203 Y1193F Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sec23ip C T 7: 128,745,003 probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 intron probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 intron probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAACTTACCAGAGGCTCCAGC -3'
(R):5'- CAGAGCACAAGTAGTCATAAGATAC -3'

Sequencing Primer
(F):5'- AGCTTCACAGGCTGCTGTC -3'
(R):5'- GTCATAAGATACCCTTGGCACATG -3'
Posted On2019-09-13