Mutagenetix > Incidental Mutation

Incidental Mutation 'R0648:Ncstn'

57317

Institutional Source

Beutler Lab

Gene Symbol

Ncstn

Ensembl Gene

ENSMUSG00000003458

Gene Name

nicastrin

Synonyms

Nct, nicastrin, D1Dau13e, 9430068N19Rik

MMRRC Submission

038833-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0648 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172066013-172082795 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 172067887 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 565 (V565F)

Ref Sequence

ENSEMBL: ENSMUSP00000003550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]

AlphaFold

P57716

Predicted Effect

probably benign
Transcript: ENSMUST00000003550
AA Change: V565F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: V565F

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Peptidase_M28	254	468	2.9e-7	PFAM
Pfam:Nicastrin	273	498	1.6e-94	PFAM
transmembrane domain	669	691	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135928

Predicted Effect

probably benign
Transcript: ENSMUST00000140643

SMART Domains

Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146137

SMART Domains

Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Meta Mutation Damage Score

0.0698

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,330,969	F46L	probably benign	Het
Abcc5	A	G	16: 20,365,882	V1009A	possibly damaging	Het
Acta2	T	C	19: 34,248,534	I87V	probably benign	Het
Arid1a	A	G	4: 133,685,204	Y1560H	unknown	Het
Bcor	C	T	X: 12,059,051	R102Q	probably damaging	Het
Camsap2	A	T	1: 136,304,319	D179E	probably damaging	Het
Ccdc18	T	A	5: 108,135,560	S46T	probably damaging	Het
Ccdc18	A	C	5: 108,174,987	Q651P	probably damaging	Het
Cdc73	T	C	1: 143,695,462	T80A	probably benign	Het
Cdh7	T	A	1: 110,065,607		probably benign	Het
Cenpe	G	A	3: 135,230,082	G426D	probably damaging	Het
Cenpt	A	G	8: 105,844,960	V487A	probably damaging	Het
Col4a1	G	A	8: 11,246,892	P84S	unknown	Het
Dennd2d	A	G	3: 106,500,555	I450M	probably damaging	Het
Dhps	C	A	8: 85,073,282		probably null	Het
Ebf1	A	T	11: 44,991,510	H431L	probably damaging	Het
Efcab6	A	G	15: 83,933,064		probably benign	Het
Egflam	T	C	15: 7,207,709	H990R	probably damaging	Het
Ercc6l2	A	G	13: 63,844,645	T303A	probably benign	Het
Fam160a1	A	C	3: 85,730,614	V126G	probably damaging	Het
Fam167b	T	C	4: 129,578,357	K7E	probably benign	Het
Fgd3	T	C	13: 49,296,573	I67V	probably benign	Het
Fn1	A	T	1: 71,597,585	V2045D	possibly damaging	Het
Gm10451	A	G	12: 76,451,296		noncoding transcript	Het
Gm8251	A	G	1: 44,056,563	S1792P	possibly damaging	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Gpx6	A	T	13: 21,318,877	N154Y	probably benign	Het
Haus8	C	A	8: 71,256,530	G79V	probably damaging	Het
Hdgfl1	A	T	13: 26,769,853	L79Q	probably damaging	Het
Hist2h2be	A	G	3: 96,221,535	S124G	probably benign	Het
Impdh2	T	C	9: 108,563,466	Y83H	probably benign	Het
Lama2	T	C	10: 26,989,376	T2929A	probably benign	Het
Lpin2	T	C	17: 71,229,312	S199P	probably benign	Het
Mkl1	A	G	15: 81,016,920	S457P	probably damaging	Het
Moap1	T	C	12: 102,742,517	T258A	probably benign	Het
Mrps35	C	A	6: 147,055,945	S156*	probably null	Het
Mtbp	C	T	15: 55,603,201	P537S	probably benign	Het
Nhsl1	A	G	10: 18,531,726	N1536S	possibly damaging	Het
Nkain4	T	C	2: 180,943,112	Q103R	possibly damaging	Het
Nsun2	T	A	13: 69,627,587	N383K	probably damaging	Het
Olfr1342	C	T	4: 118,690,072	V127I	probably benign	Het
Olfr820	A	G	10: 130,017,481	N40S	probably damaging	Het
Parp1	C	T	1: 180,600,440		probably benign	Het
Pkd1	G	A	17: 24,594,937	R4125H	probably damaging	Het
Plxnd1	T	C	6: 115,994,001	I269V	possibly damaging	Het
Qrich1	T	A	9: 108,544,877	N563K	probably damaging	Het
Rab3il1	TGAAG	TGAAGAAG	19: 10,027,388		probably benign	Het
Rell1	G	A	5: 63,924,745	T271M	probably benign	Het
Rgl1	A	G	1: 152,536,265		probably null	Het
Rph3a	C	T	5: 120,959,270	R261H	possibly damaging	Het
Ryr2	A	T	13: 11,724,333	M2161K	possibly damaging	Het
Scaf11	T	C	15: 96,418,458	N1075S	possibly damaging	Het
Serpina3j	A	G	12: 104,314,679	D37G	probably benign	Het
Siah2	A	G	3: 58,676,214	V217A	probably damaging	Het
Sik2	T	C	9: 50,898,745	D506G	probably benign	Het
Skap2	A	C	6: 51,879,785	V279G	probably benign	Het
Slc8a3	G	T	12: 81,314,446	T533N	probably damaging	Het
Slc9a7	A	T	X: 20,162,420		probably benign	Het
Snai3	G	T	8: 122,454,994	F241L	probably damaging	Het
Speg	T	C	1: 75,427,978	S2805P	probably benign	Het
Spink5	A	T	18: 43,999,797		probably benign	Het
Tctn1	C	T	5: 122,251,698	E254K	probably benign	Het
Tdrd3	C	T	14: 87,472,182	T100M	probably damaging	Het
Tex47	T	C	5: 7,305,215	V132A	probably benign	Het
Thbs3	A	G	3: 89,216,665		probably null	Het
Tigit	T	A	16: 43,662,038	Y111F	probably damaging	Het
Tmem245	A	G	4: 56,906,270	I148T	probably benign	Het
Tmem97	A	G	11: 78,550,539	Y39H	probably benign	Het
Tnks2	T	A	19: 36,862,074		probably null	Het
Trp53bp1	A	G	2: 121,235,707	V846A	probably benign	Het
Tulp2	T	G	7: 45,519,786	I259S	probably damaging	Het
Twistnb	C	T	12: 33,438,000	Q305*	probably null	Het
Ubxn1	G	A	19: 8,874,248	R215H	probably damaging	Het
Vmn1r17	A	G	6: 57,360,475	F253L	probably damaging	Het
Vmn2r10	T	C	5: 108,995,916	M723V	probably benign	Het
Xndc1	T	C	7: 102,078,824	V14A	possibly damaging	Het
Xpnpep1	A	G	19: 52,997,863		probably benign	Het
Yes1	T	A	5: 32,655,518	M322K	possibly damaging	Het
Zdhhc14	C	A	17: 5,493,602	N52K	probably benign	Het
Zfp42	A	G	8: 43,295,978	V162A	probably benign	Het

Other mutations in Ncstn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Ncstn	APN	1	172074401	missense	probably benign	0.02
IGL02030:Ncstn	APN	1	172072457	splice site	probably benign
IGL02470:Ncstn	APN	1	172082599	critical splice donor site	probably null
IGL02498:Ncstn	APN	1	172068592	missense	probably benign
morel	UTSW	1	172072476	missense	probably damaging	0.99
Pig	UTSW	1	172071525	missense	probably damaging	1.00
truffle	UTSW	1	172070009	missense	probably damaging	1.00
R0048:Ncstn	UTSW	1	172069961	splice site	probably benign
R0480:Ncstn	UTSW	1	172082592	splice site	probably benign
R0792:Ncstn	UTSW	1	172071505	missense	possibly damaging	0.95
R1330:Ncstn	UTSW	1	172071525	missense	probably damaging	1.00
R1524:Ncstn	UTSW	1	172072149	missense	possibly damaging	0.58
R1660:Ncstn	UTSW	1	172066772	missense	possibly damaging	0.78
R1828:Ncstn	UTSW	1	172071471	frame shift	probably null
R1892:Ncstn	UTSW	1	172071471	frame shift	probably null
R1907:Ncstn	UTSW	1	172072143	missense	probably damaging	0.97
R3722:Ncstn	UTSW	1	172067895	missense	possibly damaging	0.50
R3876:Ncstn	UTSW	1	172070073	missense	probably benign	0.02
R3946:Ncstn	UTSW	1	172067494	missense	probably benign	0.00
R3969:Ncstn	UTSW	1	172070009	missense	probably damaging	1.00
R4108:Ncstn	UTSW	1	172072544	missense	probably damaging	1.00
R4597:Ncstn	UTSW	1	172068256	nonsense	probably null
R4998:Ncstn	UTSW	1	172071520	missense	possibly damaging	0.81
R5037:Ncstn	UTSW	1	172068626	missense	probably damaging	1.00
R5150:Ncstn	UTSW	1	172067584	intron	probably benign
R5406:Ncstn	UTSW	1	172072164	missense	probably benign	0.00
R5444:Ncstn	UTSW	1	172072839	missense	possibly damaging	0.92
R5605:Ncstn	UTSW	1	172081150	intron	probably benign
R6675:Ncstn	UTSW	1	172071528	missense	probably damaging	1.00
R7268:Ncstn	UTSW	1	172081263	missense	possibly damaging	0.86
R7290:Ncstn	UTSW	1	172072806	missense	probably benign
R7871:Ncstn	UTSW	1	172075456	missense	probably benign	0.00
R8238:Ncstn	UTSW	1	172072476	missense	probably damaging	0.99
R9462:Ncstn	UTSW	1	172072140	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCCCAACTTCTCCGAGGGAAAG -3'
(R):5'- ATGCCTGCGAGGATGATACCTCTG -3'

Sequencing Primer
(F):5'- CTTCTCCGAGGGAAAGAGGTC -3'
(R):5'- GGTTCCTGGTTAGAGCTAACAAC -3'

Posted On

2013-07-11