Incidental Mutation 'R0648:Parp1'
ID57318
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Namepoly (ADP-ribose) polymerase family, member 1
SynonymsAdprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R0648 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location180568924-180601254 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 180600440 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777]
Predicted Effect probably benign
Transcript: ENSMUST00000027777
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193238
Predicted Effect probably benign
Transcript: ENSMUST00000195560
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 unclassified probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 intron probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2874:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4342:Parp1 UTSW 1 180587329 missense probably benign 0.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4529:Parp1 UTSW 1 180591312 missense probably damaging 1.00
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6666:Parp1 UTSW 1 180585951 missense probably benign
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6918:Parp1 UTSW 1 180588670 missense possibly damaging 0.46
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
R7156:Parp1 UTSW 1 180599064 missense possibly damaging 0.91
R7326:Parp1 UTSW 1 180569100 missense possibly damaging 0.94
R7603:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7733:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7772:Parp1 UTSW 1 180589398 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACGACACCTGCCTGCTGTATAATG -3'
(R):5'- ACCCTTCCTAAGGAGATTCGGTGAG -3'

Sequencing Primer
(F):5'- ACCTGCCTGCTGTATAATGAGTATC -3'
(R):5'- AGATTCGGTGAGGGGGC -3'
Posted On2013-07-11