Incidental Mutation 'R7387:Pkd1l1'
ID573193
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7387 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8901203 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1193 (Y1193F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: Y1193F

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178195
AA Change: Y743F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: Y743F

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cachd1 T C 4: 100,777,178 V17A unknown Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dnah6 G A 6: 73,212,612 Q18* probably null Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Ern1 A T 11: 106,421,952 V201E probably damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itga10 A T 3: 96,652,778 Q536L probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrp4 T C 2: 91,476,614 V360A probably benign Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sec23ip C T 7: 128,745,003 probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- TGTGTTAGTACCCAGGAGGAGC -3'
(R):5'- TCTCTCAGACGAGCATCAGATTC -3'

Sequencing Primer
(F):5'- AGGAGCCTGTTCTCAGAGG -3'
(R):5'- TCAGATTCACGTAAGCACTGG -3'
Posted On2019-09-13