Incidental Mutation 'R7387:Ern1'
ID573199
Institutional Source Beutler Lab
Gene Symbol Ern1
Ensembl Gene ENSMUSG00000020715
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 1
SynonymsIre1a, Ire1alpha, 9030414B18Rik, Ire1p
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7387 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106394650-106487852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106421952 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 201 (V201E)
Ref Sequence ENSEMBL: ENSMUSP00000001059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001059] [ENSMUST00000106801]
PDB Structure
Crystal structure of murine IRE1 in complex with MKC9989 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR464 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR573 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001059
AA Change: V201E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001059
Gene: ENSMUSG00000020715
AA Change: V201E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
low complexity region 471 501 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Pfam:Pkinase 571 832 1.8e-44 PFAM
Pfam:Pkinase_Tyr 572 829 8.7e-26 PFAM
PUG 895 952 5.25e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106801
AA Change: V201E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102413
Gene: ENSMUSG00000020715
AA Change: V201E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations display embryonic lethality during organogenesis. Homozygous mice may also display decreased embryo size, impaired hematopoiesis, and/or placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cachd1 T C 4: 100,777,178 V17A unknown Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dnah6 G A 6: 73,212,612 Q18* probably null Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itga10 A T 3: 96,652,778 Q536L probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrp4 T C 2: 91,476,614 V360A probably benign Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pkd1l1 T A 11: 8,901,203 Y1193F Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sec23ip C T 7: 128,745,003 probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Ern1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ern1 APN 11 106421967 missense probably benign 0.02
IGL01938:Ern1 APN 11 106411657 missense probably benign
IGL02813:Ern1 APN 11 106423425 missense probably damaging 1.00
IGL02928:Ern1 APN 11 106405879 splice site probably benign
IGL02931:Ern1 APN 11 106423440 missense probably damaging 1.00
IGL03153:Ern1 APN 11 106410098 missense possibly damaging 0.63
Immoderate UTSW 11 106420042 missense possibly damaging 0.93
Militant UTSW 11 106411652 missense probably damaging 1.00
K7371:Ern1 UTSW 11 106400275 missense probably damaging 1.00
R0090:Ern1 UTSW 11 106405823 missense probably damaging 1.00
R0391:Ern1 UTSW 11 106407178 nonsense probably null
R0411:Ern1 UTSW 11 106398586 missense probably benign
R0627:Ern1 UTSW 11 106398693 missense probably benign 0.00
R1416:Ern1 UTSW 11 106421980 splice site probably benign
R1831:Ern1 UTSW 11 106399842 splice site probably null
R1837:Ern1 UTSW 11 106458957 missense probably damaging 1.00
R1944:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1945:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1954:Ern1 UTSW 11 106421974 splice site probably benign
R1957:Ern1 UTSW 11 106426897 missense probably damaging 1.00
R2192:Ern1 UTSW 11 106409924 missense probably benign
R4276:Ern1 UTSW 11 106407181 missense probably benign
R4277:Ern1 UTSW 11 106407181 missense probably benign
R4471:Ern1 UTSW 11 106420042 missense possibly damaging 0.93
R4583:Ern1 UTSW 11 106407205 missense probably damaging 1.00
R4731:Ern1 UTSW 11 106434850 intron probably benign
R5177:Ern1 UTSW 11 106411775 missense probably benign 0.01
R5489:Ern1 UTSW 11 106407529 missense probably damaging 1.00
R5538:Ern1 UTSW 11 106421901 missense possibly damaging 0.83
R5806:Ern1 UTSW 11 106398705 missense probably damaging 0.96
R5922:Ern1 UTSW 11 106421730 missense probably damaging 0.97
R5931:Ern1 UTSW 11 106426873 missense possibly damaging 0.86
R5990:Ern1 UTSW 11 106411769 missense probably benign
R6149:Ern1 UTSW 11 106405815 nonsense probably null
R6253:Ern1 UTSW 11 106426908 missense possibly damaging 0.89
R6721:Ern1 UTSW 11 106411652 missense probably damaging 1.00
R6957:Ern1 UTSW 11 106403539 missense probably damaging 1.00
R7362:Ern1 UTSW 11 106437123 missense probably damaging 1.00
R7494:Ern1 UTSW 11 106407535 missense probably damaging 1.00
R7514:Ern1 UTSW 11 106409893 critical splice donor site probably null
R7767:Ern1 UTSW 11 106400308 missense probably damaging 1.00
R7811:Ern1 UTSW 11 106434868 missense unknown
R7869:Ern1 UTSW 11 106459019 nonsense probably null
R7952:Ern1 UTSW 11 106459019 nonsense probably null
X0021:Ern1 UTSW 11 106398606 missense probably damaging 1.00
X0022:Ern1 UTSW 11 106458919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGGGAATGGATACTTCCAC -3'
(R):5'- AGCCAGGCATATCACAGTGTC -3'

Sequencing Primer
(F):5'- TTCCCCAGACATGAAGGTCAAGTAG -3'
(R):5'- CAGGCATATCACAGTGTCTTAAAAC -3'
Posted On2019-09-13