Mutagenetix > Incidental Mutation

Incidental Mutation 'R7388:Lamc1'

573229

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7388 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153249076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 650 (T650A)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027752
AA Change: T650A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: T650A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Meta Mutation Damage Score

0.5349

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	T	C	3: 108,543,499	F86L	possibly damaging	Het
Afg3l2	T	C	18: 67,422,953	E436G	probably damaging	Het
Agbl5	T	A	5: 30,903,239	L759*	probably null	Het
Ankrd13b	T	C	11: 77,472,757	D460G	probably benign	Het
Apol10a	A	G	15: 77,489,025	D287G	possibly damaging	Het
Arhgap44	A	T	11: 65,024,268	Y391*	probably null	Het
Asz1	G	T	6: 18,074,901	S271R	probably benign	Het
AW554918	A	G	18: 25,340,113	N325D	probably benign	Het
Brinp2	A	T	1: 158,255,009	L247Q	probably damaging	Het
Casz1	A	G	4: 148,952,393	D1704G	unknown	Het
Cdk5rap1	G	A	2: 154,360,675	R212W	probably damaging	Het
Cdkl2	T	A	5: 92,019,459	T444S	probably benign	Het
Cers2	T	G	3: 95,321,345	F160V	probably benign	Het
Cga	T	A	4: 34,907,076	M99K	probably benign	Het
Cspp1	C	T	1: 10,065,347	R138*	probably null	Het
Dao	T	G	5: 114,015,212	*133E	probably null	Het
Ddx1	A	T	12: 13,225,455	C544S	probably null	Het
Dgkq	A	T	5: 108,658,246	V98E	probably damaging	Het
Dnah6	T	A	6: 73,192,317	T434S	possibly damaging	Het
Dntt	A	G	19: 41,038,979	N162D	probably benign	Het
Dpysl5	T	C	5: 30,745,461	V79A	probably benign	Het
E130309D02Rik	G	A	5: 143,311,845	A149V	probably benign	Het
Ep300	T	C	15: 81,648,366	C1602R	unknown	Het
Flrt3	C	T	2: 140,661,752		probably null	Het
Gk2	A	G	5: 97,456,898	V27A	probably damaging	Het
Gm11639	T	C	11: 104,721,045	L571P	probably damaging	Het
Gnpat	T	G	8: 124,887,814	M663R	probably benign	Het
Hc	A	T	2: 34,984,847		probably null	Het
Il12rb1	A	G	8: 70,810,627	Y67C	probably damaging	Het
Kmt2b	C	T	7: 30,581,960	D1229N	probably damaging	Het
Lrp1	G	A	10: 127,583,897	R948*	probably null	Het
Map3k21	T	C	8: 125,927,597	I385T	probably damaging	Het
Mmrn1	T	A	6: 60,976,252	S506T	probably benign	Het
Nlrp1a	A	G	11: 71,123,197	F409S	probably damaging	Het
Nlrp3	T	A	11: 59,565,066	I896N	probably benign	Het
Noxred1	C	A	12: 87,227,025	V81L	probably damaging	Het
Nrcam	A	T	12: 44,598,489	I1225F	probably damaging	Het
Olfr30	C	T	11: 58,455,655	C98Y	probably damaging	Het
Otos	T	A	1: 92,644,519		probably null	Het
Pcdh20	A	G	14: 88,468,667	I399T	probably benign	Het
Pkhd1	C	T	1: 20,239,304	V2807I	not run	Het
Prrx2	A	G	2: 30,880,890	E235G	probably damaging	Het
Rab13	T	C	3: 90,221,020	I41T	probably damaging	Het
Rai1	A	C	11: 60,189,375	T1422P	possibly damaging	Het
Rcn1	C	T	2: 105,391,991	V217M	probably damaging	Het
Scn2a	T	A	2: 65,688,654	V408E	probably damaging	Het
Sec16a	C	T	2: 26,428,364	A121T		Het
Slc35d1	A	G	4: 103,189,785		probably null	Het
Slc39a6	A	T	18: 24,584,049	V642E	probably damaging	Het
Slc6a19	G	A	13: 73,693,084	A69V	probably benign	Het
Spink6	A	T	18: 44,082,319	T79S	probably damaging	Het
Spire1	T	C	18: 67,519,880	D170G	probably damaging	Het
Sugp1	T	C	8: 70,052,619	S79P	probably damaging	Het
Syne3	A	G	12: 104,967,908	Y201H	probably damaging	Het
Tbc1d10a	T	C	11: 4,205,858		probably null	Het
Tmem14a	C	T	1: 21,229,511	Q122*	probably null	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Trmt61a	A	G	12: 111,678,887	I86V	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,966		probably null	Het
Vmn1r79	T	A	7: 12,176,741	Y183*	probably null	Het
Vmn2r11	A	T	5: 109,054,876	W112R	probably benign	Het
Vpreb1	T	C	16: 16,868,652	K125E	probably benign	Het
Wdr6	A	T	9: 108,574,772	F637L	probably damaging	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCAATGTTCACAGGGTAATAC -3'
(R):5'- AAGCTGGCAATGCTCTCTTTC -3'

Sequencing Primer
(F):5'- CAGATCACTTGATAATTACATGGCAG -3'
(R):5'- AAGCTGGCAATGCTCTCTTTCATTTG -3'

Posted On

2019-09-13