Incidental Mutation 'R7388:Sec16a'
ID573231
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7388 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26428364 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 121 (A121T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: A1572T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: A1572T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114082
AA Change: A1572T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: A1572T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924
AA Change: A121T

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26438748 missense
Z1177:Sec16a UTSW 2 26439321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCCGGCCATACAGCAAG -3'
(R):5'- CCCACATGAAGAGTCAGGCTTC -3'

Sequencing Primer
(F):5'- TCACGGAACCGCTCAGTCTC -3'
(R):5'- GGCTGGAAACCTTGTTTC -3'
Posted On2019-09-13