Incidental Mutation 'R7388:Prrx2'
ID573232
Institutional Source Beutler Lab
Gene Symbol Prrx2
Ensembl Gene ENSMUSG00000039476
Gene Namepaired related homeobox 2
SynonymsPrx2, S8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7388 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30834972-30881251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30880890 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 235 (E235G)
Ref Sequence ENSEMBL: ENSMUSP00000040332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041659] [ENSMUST00000113592]
Predicted Effect probably damaging
Transcript: ENSMUST00000041659
AA Change: E235G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040332
Gene: ENSMUSG00000039476
AA Change: E235G

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 44 80 N/A INTRINSIC
HOX 98 160 2e-26 SMART
Pfam:OAR 219 239 2.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113592
AA Change: E163G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109222
Gene: ENSMUSG00000039476
AA Change: E163G

DomainStartEndE-ValueType
HOX 26 88 2e-26 SMART
Pfam:OAR 147 167 6.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins. Expression is localized to proliferating fetal fibroblasts and the developing dermal layer, with downregulated expression in adult skin. Increases in expression of this gene during fetal but not adult wound healing suggest a possible role in mechanisms that control mammalian dermal regeneration and prevent formation of scar response to wounding. The expression patterns provide evidence consistent with a role in fetal skin development and a possible role in cellular proliferation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal, but Prrx1/Prrx2 double knockout homozygotes exhibit more severe skeletal defects than Prrx1 single knockout mutants, involving structures unaffected in the latter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Prrx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5906:Prrx2 UTSW 2 30879510 missense probably damaging 1.00
R7134:Prrx2 UTSW 2 30878473 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTATGTCTGGAAGCTTGTCTC -3'
(R):5'- CTCTGGAACTCAGGAAGCTGTG -3'

Sequencing Primer
(F):5'- GAAGCTTGTCTCCTCCCCCAAC -3'
(R):5'- CTCAGGAAGCTGTGATGGAG -3'
Posted On2019-09-13