Incidental Mutation 'R7388:Scn2a'
ID 573233
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7388 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 65620771-65767447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65688654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 408 (V408E)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: V408E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: V408E

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: V408E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: V408E

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144254
AA Change: V408E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: V408E

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: V408E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: V408E

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
R8897:Scn2a UTSW 2 65715658 critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65763670 missense probably damaging 0.99
R8992:Scn2a UTSW 2 65763898 missense probably damaging 1.00
R9190:Scn2a UTSW 2 65681002 missense probably benign 0.00
R9206:Scn2a UTSW 2 65717787 missense probably damaging 1.00
R9355:Scn2a UTSW 2 65764089 missense probably damaging 1.00
R9452:Scn2a UTSW 2 65764819 missense probably benign
R9529:Scn2a UTSW 2 65764588 missense probably damaging 0.99
R9567:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R9569:Scn2a UTSW 2 65730278 missense probably damaging 1.00
R9657:Scn2a UTSW 2 65735688 missense probably damaging 1.00
R9715:Scn2a UTSW 2 65748805 missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65735686 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGGAAGCATGAGACTCTTGACC -3'
(R):5'- CAATGTCAACAGCAGCCTTC -3'

Sequencing Primer
(F):5'- TCTTGACCAAGGGAACTGCTG -3'
(R):5'- GTCAACAGCAGCCTTCAGGTC -3'
Posted On 2019-09-13