Incidental Mutation 'R7388:Slc35d1'
ID573242
Institutional Source Beutler Lab
Gene Symbol Slc35d1
Ensembl Gene ENSMUSG00000028521
Gene Namesolute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
SynonymsUGTREL7
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7388 (G1)
Quality Score182.009
Status Validated
Chromosome4
Chromosomal Location103170649-103215164 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 103189785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036195] [ENSMUST00000150285]
Predicted Effect probably null
Transcript: ENSMUST00000036195
SMART Domains Protein: ENSMUSP00000037617
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
Pfam:TPT 18 307 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150285
SMART Domains Protein: ENSMUSP00000122124
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 158 177 N/A INTRINSIC
transmembrane domain 187 205 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 259 281 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of cellular glycoconjugates occurs in the endoplasmic reticulum (ER) and Golgi compartment, and requires transport of nucleotide sugars from the cytosol into the lumen of the ER and Golgi by specific transporters. The protein encoded by this gene resides in the ER, and transports both UDP-glucuronic acid (UDP-GlcA) and UDP-N-acetylgalactosamine (UDP-GalNAc) from the cytoplasm to the ER lumen. It may participate in glucuronidation and/or chondroitin sulfate biosynthesis. Mutations in this gene are associated with Schneckenbecken dysplasia.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality and chondrodystrophy associated with impaired chondroitin sulfate biosynthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Slc35d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Slc35d1 APN 4 103211325 missense probably benign 0.00
IGL03198:Slc35d1 APN 4 103184888 missense probably damaging 1.00
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0132:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0208:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0270:Slc35d1 UTSW 4 103190838 missense probably damaging 0.98
R0346:Slc35d1 UTSW 4 103190847 missense probably damaging 0.96
R0388:Slc35d1 UTSW 4 103184887 nonsense probably null
R0638:Slc35d1 UTSW 4 103213244 splice site probably benign
R2146:Slc35d1 UTSW 4 103205152 missense probably damaging 0.99
R3722:Slc35d1 UTSW 4 103208124 missense possibly damaging 0.93
R4649:Slc35d1 UTSW 4 103213229 missense probably damaging 1.00
R5137:Slc35d1 UTSW 4 103214781 missense possibly damaging 0.71
R5327:Slc35d1 UTSW 4 103213186 missense probably damaging 1.00
R5351:Slc35d1 UTSW 4 103189839 missense probably damaging 1.00
R5395:Slc35d1 UTSW 4 103211375 critical splice acceptor site probably null
R6263:Slc35d1 UTSW 4 103208168 missense possibly damaging 0.93
R6470:Slc35d1 UTSW 4 103189822 missense probably damaging 1.00
R7344:Slc35d1 UTSW 4 103213046 splice site probably null
R7580:Slc35d1 UTSW 4 103208133 missense
R7729:Slc35d1 UTSW 4 103214847 missense probably damaging 0.99
R7942:Slc35d1 UTSW 4 103213163 critical splice donor site probably null
R8408:Slc35d1 UTSW 4 103189810 missense
R8444:Slc35d1 UTSW 4 103214699 missense
R8692:Slc35d1 UTSW 4 103189854 missense
R8730:Slc35d1 UTSW 4 103173754 missense
R8868:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R8894:Slc35d1 UTSW 4 103211332 missense
Predicted Primers PCR Primer
(F):5'- TGGGTGGCACTCATCTCATG -3'
(R):5'- AAAGCTCTCAGTTGCTCAGAG -3'

Sequencing Primer
(F):5'- GGCACTCATCTCATGGTATGTAAACG -3'
(R):5'- TCAGTTGCTCAGAGCCTGC -3'
Posted On2019-09-13