Incidental Mutation 'R7388:Nlrp3'
ID 573266
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 045470-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7388 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59455892 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 896 (I896N)
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
AlphaFold Q8R4B8
Predicted Effect probably benign
Transcript: ENSMUST00000079476
AA Change: I896N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: I896N

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101148
AA Change: I896N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: I896N

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 T C 18: 67,556,023 (GRCm39) E436G probably damaging Het
Agbl5 T A 5: 31,060,583 (GRCm39) L759* probably null Het
Ankrd13b T C 11: 77,363,583 (GRCm39) D460G probably benign Het
Apol10a A G 15: 77,373,225 (GRCm39) D287G possibly damaging Het
Arhgap44 A T 11: 64,915,094 (GRCm39) Y391* probably null Het
Asz1 G T 6: 18,074,900 (GRCm39) S271R probably benign Het
AW554918 A G 18: 25,473,170 (GRCm39) N325D probably benign Het
Brinp2 A T 1: 158,082,579 (GRCm39) L247Q probably damaging Het
Casz1 A G 4: 149,036,850 (GRCm39) D1704G unknown Het
Cdk5rap1 G A 2: 154,202,595 (GRCm39) R212W probably damaging Het
Cdkl2 T A 5: 92,167,318 (GRCm39) T444S probably benign Het
Cers2 T G 3: 95,228,656 (GRCm39) F160V probably benign Het
Cfap276 T C 3: 108,450,815 (GRCm39) F86L possibly damaging Het
Cga T A 4: 34,907,076 (GRCm39) M99K probably benign Het
Cspp1 C T 1: 10,135,572 (GRCm39) R138* probably null Het
Dao T G 5: 114,153,273 (GRCm39) *133E probably null Het
Ddx1 A T 12: 13,275,456 (GRCm39) C544S probably null Het
Dgkq A T 5: 108,806,112 (GRCm39) V98E probably damaging Het
Dnah6 T A 6: 73,169,300 (GRCm39) T434S possibly damaging Het
Dntt A G 19: 41,027,418 (GRCm39) N162D probably benign Het
Dpysl5 T C 5: 30,902,805 (GRCm39) V79A probably benign Het
Efcab3 T C 11: 104,611,871 (GRCm39) L571P probably damaging Het
Ep300 T C 15: 81,532,567 (GRCm39) C1602R unknown Het
Flrt3 C T 2: 140,503,672 (GRCm39) probably null Het
Gk2 A G 5: 97,604,757 (GRCm39) V27A probably damaging Het
Gnpat T G 8: 125,614,553 (GRCm39) M663R probably benign Het
Hc A T 2: 34,874,859 (GRCm39) probably null Het
Il12rb1 A G 8: 71,263,271 (GRCm39) Y67C probably damaging Het
Ints15 G A 5: 143,297,600 (GRCm39) A149V probably benign Het
Kmt2b C T 7: 30,281,385 (GRCm39) D1229N probably damaging Het
Lamc1 T C 1: 153,124,822 (GRCm39) T650A probably damaging Het
Lrp1 G A 10: 127,419,766 (GRCm39) R948* probably null Het
Map3k21 T C 8: 126,654,336 (GRCm39) I385T probably damaging Het
Mmrn1 T A 6: 60,953,236 (GRCm39) S506T probably benign Het
Nlrp1a A G 11: 71,014,023 (GRCm39) F409S probably damaging Het
Noxred1 C A 12: 87,273,799 (GRCm39) V81L probably damaging Het
Nrcam A T 12: 44,645,272 (GRCm39) I1225F probably damaging Het
Or2z2 C T 11: 58,346,481 (GRCm39) C98Y probably damaging Het
Otos T A 1: 92,572,241 (GRCm39) probably null Het
Pcdh20 A G 14: 88,706,103 (GRCm39) I399T probably benign Het
Pkhd1 C T 1: 20,309,528 (GRCm39) V2807I not run Het
Prrx2 A G 2: 30,770,902 (GRCm39) E235G probably damaging Het
Rab13 T C 3: 90,128,327 (GRCm39) I41T probably damaging Het
Rai1 A C 11: 60,080,201 (GRCm39) T1422P possibly damaging Het
Rcn1 C T 2: 105,222,336 (GRCm39) V217M probably damaging Het
Scn2a T A 2: 65,518,998 (GRCm39) V408E probably damaging Het
Sec16a C T 2: 26,318,376 (GRCm39) A121T Het
Slc35d1 A G 4: 103,046,982 (GRCm39) probably null Het
Slc39a6 A T 18: 24,717,106 (GRCm39) V642E probably damaging Het
Slc6a19 G A 13: 73,841,203 (GRCm39) A69V probably benign Het
Spink6 A T 18: 44,215,386 (GRCm39) T79S probably damaging Het
Spire1 T C 18: 67,652,950 (GRCm39) D170G probably damaging Het
Sugp1 T C 8: 70,505,269 (GRCm39) S79P probably damaging Het
Syne3 A G 12: 104,934,167 (GRCm39) Y201H probably damaging Het
Tbc1d10a T C 11: 4,155,858 (GRCm39) probably null Het
Tmem14a C T 1: 21,299,735 (GRCm39) Q122* probably null Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Trmt61a A G 12: 111,645,321 (GRCm39) I86V possibly damaging Het
Tubgcp4 G A 2: 121,020,447 (GRCm39) probably null Het
Vmn1r79 T A 7: 11,910,668 (GRCm39) Y183* probably null Het
Vmn2r11 A T 5: 109,202,742 (GRCm39) W112R probably benign Het
Vpreb1a T C 16: 16,686,516 (GRCm39) K125E probably benign Het
Wdr6 A T 9: 108,451,971 (GRCm39) F637L probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCTCTCCTGTGGGATCCAG -3'
(R):5'- ATTTGCATCAGGGTTGCTCCAG -3'

Sequencing Primer
(F):5'- AGAGACGTGGAGCCATGCTTC -3'
(R):5'- CCATGTTCCCATCACCTCAGG -3'
Posted On 2019-09-13