Incidental Mutation 'R7388:Ankrd13b'
ID573270
Institutional Source Beutler Lab
Gene Symbol Ankrd13b
Ensembl Gene ENSMUSG00000037907
Gene Nameankyrin repeat domain 13b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R7388 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77470485-77489678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77472757 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 460 (D460G)
Ref Sequence ENSEMBL: ENSMUSP00000073584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021190] [ENSMUST00000037593] [ENSMUST00000052515] [ENSMUST00000079770] [ENSMUST00000092892] [ENSMUST00000102493] [ENSMUST00000108391] [ENSMUST00000145934]
Predicted Effect probably benign
Transcript: ENSMUST00000021190
SMART Domains Protein: ENSMUSP00000021190
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037593
AA Change: D460G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907
AA Change: D460G

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052515
SMART Domains Protein: ENSMUSP00000056862
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079770
SMART Domains Protein: ENSMUSP00000078703
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092892
AA Change: D460G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907
AA Change: D460G

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102493
SMART Domains Protein: ENSMUSP00000099551
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108391
SMART Domains Protein: ENSMUSP00000104028
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127291
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145934
AA Change: D245G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907
AA Change: D245G

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Ankrd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ankrd13b APN 11 77472752 missense probably damaging 1.00
IGL01396:Ankrd13b APN 11 77472372 unclassified probably null
IGL02731:Ankrd13b APN 11 77476219 missense probably damaging 0.99
R0310:Ankrd13b UTSW 11 77472745 missense possibly damaging 0.71
R0496:Ankrd13b UTSW 11 77473041 missense probably damaging 1.00
R0511:Ankrd13b UTSW 11 77473288 missense possibly damaging 0.89
R0831:Ankrd13b UTSW 11 77472759 missense probably damaging 0.99
R1156:Ankrd13b UTSW 11 77472861 missense probably damaging 1.00
R1237:Ankrd13b UTSW 11 77474574 missense probably damaging 1.00
R2259:Ankrd13b UTSW 11 77476342 missense probably damaging 1.00
R3110:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R3112:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R4190:Ankrd13b UTSW 11 77476375 missense probably damaging 1.00
R4471:Ankrd13b UTSW 11 77476214 missense probably damaging 1.00
R4599:Ankrd13b UTSW 11 77471668 missense probably benign
R5253:Ankrd13b UTSW 11 77473235 intron probably benign
R5677:Ankrd13b UTSW 11 77477544 missense probably damaging 0.99
R7073:Ankrd13b UTSW 11 77472509 missense probably benign 0.39
R7417:Ankrd13b UTSW 11 77476194 missense probably damaging 0.97
R7592:Ankrd13b UTSW 11 77476501 missense probably benign 0.45
R7596:Ankrd13b UTSW 11 77472314 missense probably benign 0.18
R7643:Ankrd13b UTSW 11 77473085 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCATCACGAGGCACAGC -3'
(R):5'- TCTGGGGCCTAGATATGAGG -3'

Sequencing Primer
(F):5'- AGCACACTGTAGCCACGTG -3'
(R):5'- CCTAGATATGAGGGAGGGGCTAGATG -3'
Posted On2019-09-13