Incidental Mutation 'R7388:Noxred1'
ID573274
Institutional Source Beutler Lab
Gene Symbol Noxred1
Ensembl Gene ENSMUSG00000072919
Gene NameNADP+ dependent oxidoreductase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7388 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87221040-87238732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87227025 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 81 (V81L)
Ref Sequence ENSEMBL: ENSMUSP00000152486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]
Predicted Effect probably damaging
Transcript: ENSMUST00000021423
AA Change: V81L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: V81L

DomainStartEndE-ValueType
Pfam:F420_oxidored 80 173 1.1e-9 PFAM
low complexity region 261 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221768
AA Change: V81L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000222480
AA Change: V81L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Noxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Noxred1 APN 12 87223181 missense probably benign 0.05
IGL01950:Noxred1 APN 12 87221416 missense probably damaging 1.00
IGL02381:Noxred1 APN 12 87225002 missense probably damaging 0.98
IGL03109:Noxred1 APN 12 87233438 missense probably damaging 1.00
PIT4402001:Noxred1 UTSW 12 87227081 missense probably benign 0.00
PIT4504001:Noxred1 UTSW 12 87224879 missense possibly damaging 0.89
R0242:Noxred1 UTSW 12 87226979 missense probably benign 0.02
R0242:Noxred1 UTSW 12 87226979 missense probably benign 0.02
R0514:Noxred1 UTSW 12 87227064 missense probably benign 0.01
R0992:Noxred1 UTSW 12 87224226 missense probably benign 0.15
R1626:Noxred1 UTSW 12 87221255 makesense probably null
R2370:Noxred1 UTSW 12 87227046 missense probably benign 0.00
R3692:Noxred1 UTSW 12 87233466 missense probably benign 0.26
R4084:Noxred1 UTSW 12 87233484 missense possibly damaging 0.67
R5868:Noxred1 UTSW 12 87224202 missense possibly damaging 0.54
R6856:Noxred1 UTSW 12 87227036 missense probably benign 0.00
R6977:Noxred1 UTSW 12 87221317 missense probably null 0.00
R7535:Noxred1 UTSW 12 87233432 missense probably benign 0.00
R7737:Noxred1 UTSW 12 87221362 nonsense probably null
R7877:Noxred1 UTSW 12 87224987 missense probably benign 0.34
R7960:Noxred1 UTSW 12 87224987 missense probably benign 0.34
Z1176:Noxred1 UTSW 12 87223057 missense not run
Predicted Primers PCR Primer
(F):5'- AGACAGCTTTGTTAATGATATGCAG -3'
(R):5'- ACCCTGAAATACTGCTGCAGAAAA -3'

Sequencing Primer
(F):5'- GCTTTGTTAATGATATGCAGCCCAC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2019-09-13