Incidental Mutation 'R7388:Afg3l2'
ID573286
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene NameAFG3-like AAA ATPase 2
Synonyms2310036I02Rik, Emv66, par
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7388 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location67404767-67449166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67422953 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 436 (E436G)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: E436G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: E436G

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Hc A T 2: 34,984,847 probably null Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATCTCATCACCAAGGCTGAGG -3'
(R):5'- ACAGGATTCTGGTTCAATGGTC -3'

Sequencing Primer
(F):5'- CATGTACGCATGTGCATCAG -3'
(R):5'- TTTACAGTGTAGCCCAGGC -3'
Posted On2019-09-13