Mutagenetix > Incidental Mutations

Incidental Mutation 'R7388:Spire1'

573287

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R7388 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67519880 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 170 (D170G)

Ref Sequence

ENSEMBL: ENSMUSP00000110702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045105
AA Change: D170G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: D170G

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000082243
AA Change: D170G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: D170G

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115050
AA Change: D170G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: D170G

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224799
AA Change: D100G

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	T	C	3: 108,543,499	F86L	possibly damaging	Het
Afg3l2	T	C	18: 67,422,953	E436G	probably damaging	Het
Agbl5	T	A	5: 30,903,239	L759*	probably null	Het
Ankrd13b	T	C	11: 77,472,757	D460G	probably benign	Het
Apol10a	A	G	15: 77,489,025	D287G	possibly damaging	Het
Arhgap44	A	T	11: 65,024,268	Y391*	probably null	Het
Asz1	G	T	6: 18,074,901	S271R	probably benign	Het
AW554918	A	G	18: 25,340,113	N325D	probably benign	Het
Brinp2	A	T	1: 158,255,009	L247Q	probably damaging	Het
Casz1	A	G	4: 148,952,393	D1704G	unknown	Het
Cdk5rap1	G	A	2: 154,360,675	R212W	probably damaging	Het
Cdkl2	T	A	5: 92,019,459	T444S	probably benign	Het
Cers2	T	G	3: 95,321,345	F160V	probably benign	Het
Cga	T	A	4: 34,907,076	M99K	probably benign	Het
Cspp1	C	T	1: 10,065,347	R138*	probably null	Het
Dao	T	G	5: 114,015,212	*133E	probably null	Het
Ddx1	A	T	12: 13,225,455	C544S	probably null	Het
Dgkq	A	T	5: 108,658,246	V98E	probably damaging	Het
Dnah6	T	A	6: 73,192,317	T434S	possibly damaging	Het
Dntt	A	G	19: 41,038,979	N162D	probably benign	Het
Dpysl5	T	C	5: 30,745,461	V79A	probably benign	Het
E130309D02Rik	G	A	5: 143,311,845	A149V	probably benign	Het
Ep300	T	C	15: 81,648,366	C1602R	unknown	Het
Flrt3	C	T	2: 140,661,752		probably null	Het
Gk2	A	G	5: 97,456,898	V27A	probably damaging	Het
Gm11639	T	C	11: 104,721,045	L571P	probably damaging	Het
Gnpat	T	G	8: 124,887,814	M663R	probably benign	Het
Hc	A	T	2: 34,984,847		probably null	Het
Il12rb1	A	G	8: 70,810,627	Y67C	probably damaging	Het
Kmt2b	C	T	7: 30,581,960	D1229N	probably damaging	Het
Lamc1	T	C	1: 153,249,076	T650A	probably damaging	Het
Lrp1	G	A	10: 127,583,897	R948*	probably null	Het
Map3k21	T	C	8: 125,927,597	I385T	probably damaging	Het
Mmrn1	T	A	6: 60,976,252	S506T	probably benign	Het
Nlrp1a	A	G	11: 71,123,197	F409S	probably damaging	Het
Nlrp3	T	A	11: 59,565,066	I896N	probably benign	Het
Noxred1	C	A	12: 87,227,025	V81L	probably damaging	Het
Nrcam	A	T	12: 44,598,489	I1225F	probably damaging	Het
Olfr30	C	T	11: 58,455,655	C98Y	probably damaging	Het
Otos	T	A	1: 92,644,519		probably null	Het
Pcdh20	A	G	14: 88,468,667	I399T	probably benign	Het
Pkhd1	C	T	1: 20,239,304	V2807I	not run	Het
Prrx2	A	G	2: 30,880,890	E235G	probably damaging	Het
Rab13	T	C	3: 90,221,020	I41T	probably damaging	Het
Rai1	A	C	11: 60,189,375	T1422P	possibly damaging	Het
Rcn1	C	T	2: 105,391,991	V217M	probably damaging	Het
Scn2a	T	A	2: 65,688,654	V408E	probably damaging	Het
Sec16a	C	T	2: 26,428,364	A121T		Het
Slc35d1	A	G	4: 103,189,785		probably null	Het
Slc39a6	A	T	18: 24,584,049	V642E	probably damaging	Het
Slc6a19	G	A	13: 73,693,084	A69V	probably benign	Het
Spink6	A	T	18: 44,082,319	T79S	probably damaging	Het
Sugp1	T	C	8: 70,052,619	S79P	probably damaging	Het
Syne3	A	G	12: 104,967,908	Y201H	probably damaging	Het
Tbc1d10a	T	C	11: 4,205,858		probably null	Het
Tmem14a	C	T	1: 21,229,511	Q122*	probably null	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Trmt61a	A	G	12: 111,678,887	I86V	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,966		probably null	Het
Vmn1r79	T	A	7: 12,176,741	Y183*	probably null	Het
Vmn2r11	A	T	5: 109,054,876	W112R	probably benign	Het
Vpreb1	T	C	16: 16,868,652	K125E	probably benign	Het
Wdr6	A	T	9: 108,574,772	F637L	probably damaging	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0457:Spire1	UTSW	18	67552600	missense	probably damaging	0.98
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R0608:Spire1	UTSW	18	67528875	missense	probably damaging	0.99
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R3815:Spire1	UTSW	18	67506663	missense	probably benign	0.05
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4050:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	splice site	probably null
R5363:Spire1	UTSW	18	67506555	missense	probably damaging	1.00
R5561:Spire1	UTSW	18	67506646	missense	probably damaging	0.96
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
R8006:Spire1	UTSW	18	67501181	nonsense	probably null
R8111:Spire1	UTSW	18	67519321	missense	probably damaging	0.98
R8675:Spire1	UTSW	18	67491308	missense	possibly damaging	0.48
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AAACTGAAGGTATGTCTCTGTGC -3'
(R):5'- CAGTTGTCACAGGAGAAGAACC -3'

Sequencing Primer
(F):5'- ACTGAAGGTATGTCTCTGTGCTTTAG -3'
(R):5'- TGACCCCAGCTCTTAGGATGTAG -3'

Posted On

2019-09-13