Incidental Mutation 'R7389:Fabp2'
ID573298
Institutional Source Beutler Lab
Gene Symbol Fabp2
Ensembl Gene ENSMUSG00000023057
Gene Namefatty acid binding protein 2, intestinal
SynonymsFabpi, Fabpi, I-FABP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location122895072-122899506 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 122895365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023820]
Predicted Effect probably benign
Transcript: ENSMUST00000023820
SMART Domains Protein: ENSMUSP00000023820
Gene: ENSMUSG00000023057

DomainStartEndE-ValueType
Pfam:Lipocalin_7 1 131 1.2e-9 PFAM
Pfam:Lipocalin 4 132 4.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within enterocytes, possibly to sense lipids as part of energy homeostasis. In humans polymorphisms are associated with increased fat oxidation and insulin resistance. In mice deficiency of this gene alters body weight in a gender-specific manner and causes hyperinsulinemia. [provided by RefSeq, Jan 2013]
PHENOTYPE: Male mutant mice exhibit increased body weight, hyperinsulinemia, increased leptin levels on a high fat diet and have elevated circulating levels of triglycerides. Female mutant mice exhibit a decreased body weight on a high fat diet compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Fabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02326:Fabp2 APN 3 122898746 missense probably damaging 1.00
IGL02569:Fabp2 APN 3 122895464 missense probably damaging 0.99
R4177:Fabp2 UTSW 3 122896898 missense possibly damaging 0.62
R8190:Fabp2 UTSW 3 122896770 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATGCCCACATGCTGTAGTTG -3'
(R):5'- AGCTTTGCCACATCACAGGTC -3'

Sequencing Primer
(F):5'- CCACATGCTGTAGTTGAAGGC -3'
(R):5'- TTGCCACATCACAGGTCATTCAG -3'
Posted On2019-09-13