Incidental Mutation 'R7389:Lrriq3'
ID573299
Institutional Source Beutler Lab
Gene Symbol Lrriq3
Ensembl Gene ENSMUSG00000028182
Gene Nameleucine-rich repeats and IQ motif containing 3
Synonyms4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location155093434-155194280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155188104 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 481 (T481A)
Ref Sequence ENSEMBL: ENSMUSP00000029833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029833]
Predicted Effect probably benign
Transcript: ENSMUST00000029833
AA Change: T481A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182
AA Change: T481A

DomainStartEndE-ValueType
SCOP:d1dcea3 36 155 3e-14 SMART
Blast:LRR 71 94 3e-6 BLAST
Blast:LRR 96 118 1e-5 BLAST
IQ 214 236 3.68e0 SMART
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Lrriq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrriq3 APN 3 155101061 missense probably benign 0.29
IGL00468:Lrriq3 APN 3 155101179 missense probably damaging 1.00
IGL03272:Lrriq3 APN 3 155101058 missense probably damaging 0.99
PIT1430001:Lrriq3 UTSW 3 155098870 missense probably benign 0.36
R0526:Lrriq3 UTSW 3 155188297 missense probably benign 0.00
R0600:Lrriq3 UTSW 3 155187736 missense possibly damaging 0.51
R1420:Lrriq3 UTSW 3 155187712 missense probably benign
R2313:Lrriq3 UTSW 3 155164023 missense probably benign 0.00
R4024:Lrriq3 UTSW 3 155188302 missense probably benign 0.43
R4659:Lrriq3 UTSW 3 155129453 missense possibly damaging 0.47
R4801:Lrriq3 UTSW 3 155187970 missense probably benign
R4802:Lrriq3 UTSW 3 155187970 missense probably benign
R4864:Lrriq3 UTSW 3 155187810 missense possibly damaging 0.91
R4998:Lrriq3 UTSW 3 155188058 missense probably benign 0.13
R5120:Lrriq3 UTSW 3 155129384 missense probably benign 0.14
R5319:Lrriq3 UTSW 3 155129471 missense possibly damaging 0.88
R5406:Lrriq3 UTSW 3 155129501 critical splice donor site probably null
R5943:Lrriq3 UTSW 3 155163950 missense probably damaging 0.99
R6184:Lrriq3 UTSW 3 155129402 missense probably benign 0.09
R6572:Lrriq3 UTSW 3 155181675 missense probably benign 0.01
R7537:Lrriq3 UTSW 3 155101097 missense probably damaging 1.00
R7636:Lrriq3 UTSW 3 155188150 missense probably damaging 1.00
R7806:Lrriq3 UTSW 3 155098807 missense probably damaging 0.99
R8038:Lrriq3 UTSW 3 155164001 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGAGAGAGTTTCTAGCCACAC -3'
(R):5'- TTCAACTTGGGTAATTCCTTTGAGC -3'

Sequencing Primer
(F):5'- GCATGAAGCTCCACATGTTTG -3'
(R):5'- TCCTTTGAGCAGAATGGACC -3'
Posted On2019-09-13