Incidental Mutation 'R7389:Dqx1'
ID573304
Institutional Source Beutler Lab
Gene Symbol Dqx1
Ensembl Gene ENSMUSG00000009145
Gene NameDEAQ RNA-dependent ATPase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83057844-83067318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83064794 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 539 (S539I)
Ref Sequence ENSEMBL: ENSMUSP00000076708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077502] [ENSMUST00000089641] [ENSMUST00000174674] [ENSMUST00000204803]
Predicted Effect probably null
Transcript: ENSMUST00000077502
AA Change: S539I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145
AA Change: S539I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089641
SMART Domains Protein: ENSMUSP00000087069
Gene: ENSMUSG00000068327

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 61 N/A INTRINSIC
low complexity region 82 116 N/A INTRINSIC
HOX 157 219 1.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174674
SMART Domains Protein: ENSMUSP00000133420
Gene: ENSMUSG00000068327

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 61 N/A INTRINSIC
low complexity region 82 116 N/A INTRINSIC
HOX 157 213 2.43e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204803
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Dqx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Dqx1 APN 6 83066427 unclassified probably benign
IGL02158:Dqx1 APN 6 83058910 splice site probably benign
IGL02288:Dqx1 APN 6 83060328 missense probably damaging 0.98
IGL02801:Dqx1 APN 6 83060495 unclassified probably null
IGL02929:Dqx1 APN 6 83060484 unclassified probably benign
R0396:Dqx1 UTSW 6 83059005 missense probably benign 0.00
R0448:Dqx1 UTSW 6 83060345 missense probably damaging 1.00
R0471:Dqx1 UTSW 6 83059426 splice site probably benign
R1022:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1023:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1024:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1480:Dqx1 UTSW 6 83059452 missense possibly damaging 0.61
R1804:Dqx1 UTSW 6 83060322 missense probably damaging 1.00
R1848:Dqx1 UTSW 6 83066107 missense probably damaging 1.00
R1982:Dqx1 UTSW 6 83058577 missense probably damaging 1.00
R2064:Dqx1 UTSW 6 83058543 unclassified probably benign
R2350:Dqx1 UTSW 6 83059087 nonsense probably null
R3110:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3112:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3119:Dqx1 UTSW 6 83066235 nonsense probably null
R4179:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4180:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4873:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4875:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4882:Dqx1 UTSW 6 83066088 critical splice acceptor site probably null
R5015:Dqx1 UTSW 6 83066111 missense probably benign 0.00
R5128:Dqx1 UTSW 6 83060567 missense probably damaging 0.96
R5346:Dqx1 UTSW 6 83059719 missense possibly damaging 0.87
R5480:Dqx1 UTSW 6 83064803 missense probably damaging 0.98
R6939:Dqx1 UTSW 6 83059465 missense probably damaging 0.99
R6979:Dqx1 UTSW 6 83061011 missense probably damaging 1.00
R7059:Dqx1 UTSW 6 83064809 missense probably benign 0.18
R7084:Dqx1 UTSW 6 83066455 missense probably damaging 1.00
R7354:Dqx1 UTSW 6 83060976 nonsense probably null
R7497:Dqx1 UTSW 6 83059047 missense probably damaging 1.00
R7632:Dqx1 UTSW 6 83059699 missense probably benign
R7762:Dqx1 UTSW 6 83061032 missense probably damaging 1.00
R8002:Dqx1 UTSW 6 83058577 missense probably damaging 1.00
R8036:Dqx1 UTSW 6 83059807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGGTGATCACAGCTCTC -3'
(R):5'- TCTCCCCAACCTTGAGGAAGTATC -3'

Sequencing Primer
(F):5'- AGCTCTCTGATCCAGGTCTATGAAG -3'
(R):5'- GAAGTATCCTGACAGCAGTGCTTTC -3'
Posted On2019-09-13