Incidental Mutation 'R7389:Mybpc2'
ID573306
Institutional Source Beutler Lab
Gene Symbol Mybpc2
Ensembl Gene ENSMUSG00000038670
Gene Namemyosin binding protein C, fast-type
SynonymsFast-type C-protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44501699-44524656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44505604 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 960 (T960P)
Ref Sequence ENSEMBL: ENSMUSP00000130127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000206398]
PDB Structure Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165208
AA Change: T960P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670
AA Change: T960P

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Predicted Effect probably benign
Transcript: ENSMUST00000207516
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Mybpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Mybpc2 APN 7 44505405 unclassified probably benign
IGL00586:Mybpc2 APN 7 44505382 missense probably damaging 0.96
IGL00976:Mybpc2 APN 7 44522317 splice site probably null
IGL01099:Mybpc2 APN 7 44516167 missense probably damaging 0.99
IGL01348:Mybpc2 APN 7 44515928 missense probably benign
IGL01625:Mybpc2 APN 7 44516913 missense possibly damaging 0.65
IGL01733:Mybpc2 APN 7 44506198 missense probably benign 0.03
IGL01946:Mybpc2 APN 7 44509898 unclassified probably benign
IGL02078:Mybpc2 APN 7 44503780 missense probably damaging 1.00
IGL02314:Mybpc2 APN 7 44522388 missense possibly damaging 0.82
IGL02341:Mybpc2 APN 7 44514930 missense probably benign 0.00
IGL02904:Mybpc2 APN 7 44522341 missense probably benign 0.05
IGL03034:Mybpc2 APN 7 44511897 missense possibly damaging 0.87
IGL03296:Mybpc2 APN 7 44506884 missense probably damaging 1.00
R0094:Mybpc2 UTSW 7 44516904 missense probably damaging 1.00
R0329:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0330:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0336:Mybpc2 UTSW 7 44505616 missense probably damaging 1.00
R0503:Mybpc2 UTSW 7 44512570 unclassified probably benign
R0821:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0822:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0823:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0854:Mybpc2 UTSW 7 44517002 missense probably benign 0.06
R0938:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0939:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0940:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0941:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R1166:Mybpc2 UTSW 7 44505025 missense possibly damaging 0.84
R1219:Mybpc2 UTSW 7 44516034 splice site probably null
R1559:Mybpc2 UTSW 7 44513687 missense probably benign 0.01
R1732:Mybpc2 UTSW 7 44513675 missense probably benign
R1802:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
R2157:Mybpc2 UTSW 7 44509845 missense possibly damaging 0.93
R2216:Mybpc2 UTSW 7 44512500 splice site probably null
R2406:Mybpc2 UTSW 7 44521725 missense possibly damaging 0.62
R2411:Mybpc2 UTSW 7 44506238 missense probably damaging 1.00
R3079:Mybpc2 UTSW 7 44506081 missense probably damaging 1.00
R4663:Mybpc2 UTSW 7 44505642 missense probably damaging 0.99
R4736:Mybpc2 UTSW 7 44512547 missense probably damaging 1.00
R5316:Mybpc2 UTSW 7 44520382 nonsense probably null
R5426:Mybpc2 UTSW 7 44509829 missense probably benign 0.01
R5498:Mybpc2 UTSW 7 44516265 missense probably damaging 1.00
R5539:Mybpc2 UTSW 7 44514893 missense probably benign 0.17
R5644:Mybpc2 UTSW 7 44507053 missense probably benign 0.13
R5909:Mybpc2 UTSW 7 44507091 missense probably damaging 1.00
R6435:Mybpc2 UTSW 7 44506057 missense possibly damaging 0.73
R6662:Mybpc2 UTSW 7 44506166 missense probably benign
R6901:Mybpc2 UTSW 7 44505355 missense probably damaging 0.99
R7188:Mybpc2 UTSW 7 44506193 missense probably benign 0.06
R7405:Mybpc2 UTSW 7 44507194 missense probably damaging 1.00
R7553:Mybpc2 UTSW 7 44506147 missense possibly damaging 0.51
R7597:Mybpc2 UTSW 7 44509799 missense probably damaging 1.00
R7772:Mybpc2 UTSW 7 44515924 critical splice donor site probably null
R7824:Mybpc2 UTSW 7 44504860 splice site probably null
R8003:Mybpc2 UTSW 7 44509064 missense probably damaging 0.99
R8179:Mybpc2 UTSW 7 44509830 missense probably benign 0.01
R8187:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
R8413:Mybpc2 UTSW 7 44508305 missense probably damaging 1.00
R8729:Mybpc2 UTSW 7 44506187 missense probably damaging 1.00
R8830:Mybpc2 UTSW 7 44512541 missense probably damaging 1.00
X0052:Mybpc2 UTSW 7 44507142 missense probably benign 0.23
X0065:Mybpc2 UTSW 7 44505385 missense probably benign 0.01
Z1088:Mybpc2 UTSW 7 44516503 missense possibly damaging 0.47
Z1176:Mybpc2 UTSW 7 44521696 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGGAGGACACATGTGGG -3'
(R):5'- ACGGGATGTTTGAAGCAGGA -3'

Sequencing Primer
(F):5'- GACACATGTGGGTACAGACTC -3'
(R):5'- AATGCATTTGAGATCAGCCTGG -3'
Posted On2019-09-13