Mutagenetix > Incidental Mutation

Incidental Mutation 'R7389:Usp34'

573312

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.671) question?

Stock #

R7389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 23345200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 287 (F287L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: F287L

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000180046
AA Change: F268L

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: F268L

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Meta Mutation Damage Score

0.1580

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (49/50)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa11	C	A	14: 25,872,888	P182Q	probably damaging	Het
Asns	C	A	6: 7,689,291	L70F	probably damaging	Het
Cd163l1	A	G	7: 140,228,791	K872E	possibly damaging	Het
Cntrl	A	T	2: 35,127,517	K445N	probably benign	Het
Cyp2c50	G	T	19: 40,090,663	R150L	probably benign	Het
Dqx1	G	T	6: 83,064,794	S539I	probably null	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
Epha3	T	C	16: 63,772,984	E247G	probably damaging	Het
Etl4	C	T	2: 20,785,093	Q801*	probably null	Het
Fabp2	G	T	3: 122,895,365		probably benign	Het
Fsip2	G	A	2: 82,988,796	V4958I	possibly damaging	Het
Fstl3	G	A	10: 79,780,031	C117Y	probably damaging	Het
Hdgfl2	T	G	17: 56,099,389		probably null	Het
Igfn1	T	C	1: 135,967,047	D1927G	probably benign	Het
Ino80	A	C	2: 119,442,529	S489A	probably benign	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lrriq3	A	G	3: 155,188,104	T481A	probably benign	Het
Map2k3	A	T	11: 60,932,036		probably benign	Het
Matr3	A	G	18: 35,584,585	T617A	probably benign	Het
Mybpc2	T	G	7: 44,505,604	T960P	probably benign	Het
Ncoa2	T	C	1: 13,186,825	N150S	possibly damaging	Het
Nup153	A	T	13: 46,700,987		probably null	Het
Obscn	A	G	11: 59,036,400	L5498P	probably benign	Het
Olfr111	A	G	17: 37,530,657	R227G	possibly damaging	Het
Olfr1444	G	T	19: 12,862,617	V281L	probably benign	Het
Paqr8	C	A	1: 20,935,165	P181Q	probably damaging	Het
Pcdhgb4	T	C	18: 37,722,363	Y604H	probably damaging	Het
Pja2	T	A	17: 64,297,727	E487V	probably damaging	Het
Pnpla6	C	T	8: 3,543,981	R1331*	probably null	Het
Ppl	T	A	16: 5,106,713		probably null	Het
Rhbdl3	T	A	11: 80,346,839	M299K	possibly damaging	Het
Slc26a9	A	G	1: 131,769,248	*791W	probably null	Het
Slc7a2	A	G	8: 40,912,515	Y461C	probably benign	Het
Sptb	G	T	12: 76,624,229	Q447K	probably damaging	Het
Ssh1	A	T	5: 113,958,831	I205N	probably benign	Het
Stab1	C	T	14: 31,147,239	V1511I	probably benign	Het
Tex19.1	T	C	11: 121,147,160	W115R	possibly damaging	Het
Tinf2	G	T	14: 55,680,710		probably null	Het
Tmeff1	A	G	4: 48,617,097		probably null	Het
Tnip2	G	T	5: 34,513,801	Q33K	probably benign	Het
Traf3	C	A	12: 111,237,753	L59M	probably damaging	Het
Trav14d-3-dv8	T	C	14: 53,078,871	Y63H	possibly damaging	Het
Trim11	C	T	11: 58,990,655	S458L	probably damaging	Het
Tspan18	A	T	2: 93,209,927	V161E	probably benign	Het
Usf3	T	A	16: 44,217,941	V928E	probably benign	Het
Usp29	G	A	7: 6,963,458	V767I	possibly damaging	Het
Vmn1r213	T	C	13: 23,012,386	C380R	probably benign	Het
Zfyve9	A	G	4: 108,693,318		probably null	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATATGTGGCGTTTTAGAGGC -3'
(R):5'- GTAACGAGTTACTTTCTAAATGAGCTG -3'

Sequencing Primer
(F):5'- GAGGCAGCCAAATGTTAATTCC -3'
(R):5'- CCATAAAAATTCTGTTTAGCTCTTCC -3'

Posted On

2019-09-13