Incidental Mutation 'R7389:Map2k3'
ID573315
Institutional Source Beutler Lab
Gene Symbol Map2k3
Ensembl Gene ENSMUSG00000018932
Gene Namemitogen-activated protein kinase kinase 3
SynonymsMKK3, Prkmk3, MAP kinase kinase 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7389 (G1)
Quality Score221.009
Status Validated
Chromosome11
Chromosomal Location60932033-60952811 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 60932036 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019076] [ENSMUST00000130269]
Predicted Effect probably benign
Transcript: ENSMUST00000019076
SMART Domains Protein: ENSMUSP00000019076
Gene: ENSMUSG00000018932

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
S_TKc 64 325 1.41e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130269
SMART Domains Protein: ENSMUSP00000114430
Gene: ENSMUSG00000018932

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Pkinase 64 173 1.3e-12 PFAM
Pfam:Pkinase_Tyr 64 173 3.5e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but display abnormalities in cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Map2k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Map2k3 APN 11 60943215 missense possibly damaging 0.54
IGL00901:Map2k3 APN 11 60941921 missense probably benign 0.00
IGL01620:Map2k3 APN 11 60950047 missense possibly damaging 0.86
IGL02197:Map2k3 APN 11 60946764 missense probably damaging 1.00
R1907:Map2k3 UTSW 11 60932229 missense possibly damaging 0.70
R2069:Map2k3 UTSW 11 60950027 missense probably damaging 1.00
R4447:Map2k3 UTSW 11 60947171 missense probably damaging 1.00
R5106:Map2k3 UTSW 11 60941882 missense probably damaging 0.97
R5163:Map2k3 UTSW 11 60943491 missense probably damaging 1.00
R6043:Map2k3 UTSW 11 60946746 missense probably benign 0.01
R6147:Map2k3 UTSW 11 60949950 nonsense probably null
R6659:Map2k3 UTSW 11 60942324 missense probably benign 0.45
R7206:Map2k3 UTSW 11 60943580 missense
R7261:Map2k3 UTSW 11 60945567 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCATCTAGACGGCAAGAGGG -3'
(R):5'- CCTACCTTTGGTCTGAGGCAAG -3'

Sequencing Primer
(F):5'- CTGTACTAAGGGGAAAGCT -3'
(R):5'- TGGTCTGAGGCAAGCTGGC -3'
Posted On2019-09-13