Incidental Mutation 'R7389:Traf3'
ID573320
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111237753 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 59 (L59M)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269] [ENSMUST00000139162]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021706
AA Change: L59M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: L59M

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060274
AA Change: L59M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: L59M

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117269
AA Change: L59M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: L59M

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139162
AA Change: L59M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119010
Gene: ENSMUSG00000021277
AA Change: L59M

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Meta Mutation Damage Score 0.6220 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
Han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 missense probably benign 0.03
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R6933:Traf3 UTSW 12 111255224 missense possibly damaging 0.80
R7425:Traf3 UTSW 12 111260661 nonsense probably null
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Z1176:Traf3 UTSW 12 111261836 missense probably damaging 1.00
Z1177:Traf3 UTSW 12 111261492 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGGGGTTGACTGACAGTTCTC -3'
(R):5'- TCTCAGGCACTCAAGCATG -3'

Sequencing Primer
(F):5'- CCGGGCAGAATTTCAGTTTCCTAAG -3'
(R):5'- TCAAGCATGAGATGTGCCTG -3'
Posted On2019-09-13